Labshake search
Citations for Takara Bio :
1551 - 1600 of 2364 citations for 6 AMINO 6 DEOXY 1 2 3 4 DI O ISOPROPYLIDENE D GALACTOPYRANOSIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: KOD-Plus-Ver.2 DNA polymerase (Toyobo, Osaka, Japan) was used to amplify ldsDNAs (PCR amplicons) using the pEGFP-C1 (Clontech, Mountain View, CA, USA) plasmid as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with a mix of up to three primary antibodies simultaneously diluted in PBST with 1 % NDS overnight at room temperature with the following primary antibodies: rabbit anti-dsRed (1:1000; Clontech, AB_10013483), chicken anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and then incubated with a GFP antiserum (rabbit, 1:1000, Life Technology, #A6455) or an mCherry antiserum (mouse, 1:1000, Clontech, #632543). Primary antisera were diluted in PBS with 2% NGS overnight at 4°C ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed on 1 μL of 1 in 40 diluted cDNA in 15 μL reactions using SYBR Premix Ex-Taq II reagent (Takara Bio) in a Bio-Rad CFX96 real-time system (see Table S1 for primer pairs) ...
-
bioRxiv - Genetics 2020Quote: ... Membranes were blocked in 5% milk for 1 h at room temperature and then probed with mouse-anti-EGFP (for pYFP constructs; 1:8000; Clontech, 632380) or mouse-anti-V5 tag (1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then incubated overnight at 4°C with the following primary antibodies diluted in PBS - 0.3% Triton X100 - 1% NGS: rabbit anti-ZsGreen (1/1000, Clontech, 632474, RRID:AB_2491179) or rabbit anti- DCX (1/2000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following antibodies were used: rabbit or rat anti-dsRed (1:200, Clontech 632496 or 5F8 1:400, Chromotek 5f8-100); chicken anti-GFP (1:800 ...
-
bioRxiv - Developmental Biology 2019Quote: To quantify EEC morphology score, chick anti-GFP (Aves GFP1010, 1:500 dilution) and rabbit anti-mcherry (TAKARA 632496, 1:250 dilution) antibodies were used in the fixed Tg(gata5:lifActin-EGFP);Tg(neurod1:TagRFP ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by SDS–PAGE and immunoblotting with goat anti-GST (1:3000, Cytiva, 27-4577-01) and mouse anti-6xHis (1:3000, Takara Bio, 631212) antibodies ...
-
bioRxiv - Physiology 2022Quote: ... Cleared lysates were loaded into wells of the SDS-agarose gels (1% SeaKem Gold Agarose [Lonza, Basel, Switzerland], 30% glycerol, and 1 × Tris/glycine/SDS [TG-SDS] buffer [Takara Bio Inc.]) and then electrophoresed in a running buffer (1 × TG-SDS buffer and 10 mM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit α-RFP (1:500; Clontech, cat# 632496, RRID:AB_10013483); mouse α-lacZ antibody (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were induced with 1 µM rapalog (AP21967, Takara) for 45 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 10 U ml−1 of HRV- 3C protease (Takara) were added to the Ni-NTA eluted protein to remove the oligohistidine- GST-tag during dialysis against 3 L of dialysis buffer I (25 mM Tris-HCl ...
-
bioRxiv - Genomics 2020Quote: ... was cloned into modified pCold-1 (Takara Bio Inc.), in which the factor Xa cleavage site was replaced with tobacco etch virus (TEV ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: 1 part of Lenti-X™ concentrator (TaKaRa; 631232) was first mixed with 3 parts of supernatant and incubated at 4 °C overnight for lentivirus precipitation ...
-
bioRxiv - Genomics 2019Quote: ... once with 50 μL 1× First-Strand Buffer (Clontech) and resuspended in 38 μL reverse transcriptase solution (1× First-Strand Buffer (Clontech) ...
-
bioRxiv - Genetics 2019Quote: ... using the pEGFP-1 plasmid (Clontech, Mountain View, CA) as template ...
-
bioRxiv - Bioengineering 2019Quote: ... coli DH5α (TaKaRa, hsdR, recA, thi-1, relA1, gyrA96). E ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-DsRed (1:500, 632496, Takara Bio).
-
bioRxiv - Microbiology 2020Quote: ... Ab anti-GFP (Clontech #632592, WB dilution 1:1000), Ab Beta Actin HRP conjugated (Abcam ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit poly-clonal anti-GFP (1/800, 632592, Clontech), anti-Myosin heavy chain (1/10 ...
-
bioRxiv - Developmental Biology 2021Quote: ... stained with anti-GFP antibody (1/800, 632592, Clontech) and biotinylated anti-rabbit IgG (1/200 ...
-
bioRxiv - Neuroscience 2020Quote: ... and dsRed (1:600, Takara Bio, 632496; RRID: AB_10013483) was performed on adult brain sections of quadruple transgenic zebrafish ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with α-MYC (mouse, 1:500, Clontech #631206) in 4 % BSA-PBS for 60 min at room temperature to stain surface expressed GluK2 ...
-
bioRxiv - Neuroscience 2021Quote: - 1/1000 Rabbit α-dsRed (Takara, Living Colors 632496)
-
bioRxiv - Biochemistry 2020Quote: ... according to the Yeast Protocols Handbook (PT3024-1, Clontech).
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-dsRed dilution 1:100 (IF) (Clontech, 632496); mouse anti-M6PR dilution 1:100 (IF ...
-
bioRxiv - Physiology 2021Quote: ... 1 mL of Fruit-mate (Takara, catalog no.: 9192) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-GFP JL-8 (1:1000, Clontech 632380), polyclonal rabbit anti-RP2 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... we used 1 μL of Extaq enzyme from Takara on genomic DNA (20 μg ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 U µl−1 recombinant RNase inhibitor (Clontech)) using a Wheaton Dounce tissue grinder (15 strokes with the loose pestle) ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary Antibodies: anti-GFP (JL-8; Clontech, 1:1000), anti-Flag (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL of T4 DNA ligase (Takara Bio Inc.) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse monoclonal anti-GFP (Clontech; milk; 1:2,000).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-DSRed (targeting mCherry; 1:2000; Clontech), washed ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 μL (1 mU) of Pfu PGAP (TaKaRa) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... 1× Universal Primer Mix (first PCR, Clontech Laboratories, Inc.) or 1× Nested Universal Primer (secondary PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of PrimeScript One Step Enzyme Mix (TaKaRa), 10 μL of 2× One Step RT-PCR buffer (TaKaRa) ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit-anti-RFP (1:500, Clontech 600-401-379); mouse-anti-24B10 (Zipursky et al. ...
-
bioRxiv - Microbiology 2020Quote: ... and 10 U μl−1 PrimeScript Reverse Transcriptase (Takara) at 48 °C for 30 min ...