Labshake search
Citations for Takara Bio :
1551 - 1600 of 2207 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized CHAF1A cDNA was first cloned into a pGEX-6P-1 vector via In Fusion (Takara) (Supplementary Table 3) ...
-
bioRxiv - Immunology 2023Quote: ... and 1 µg was used for cDNA synthesis with the PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). Of the cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... the following primary antibodies were used: rabbit anti-dsRed (1:1,000, Cat.# 632496, Clontech Laboratories, Mountain View, CA), chicken anti-GFP (1:10,000 ...
-
bioRxiv - Plant Biology 2023Quote: The full-length MpACL5 amplified from Tak-1 cDNA by PCR using TaKaRA EX Taq (Takara, Shiga, Japan) with the primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized using 1 µg of RNA following manufacturers’ instruction (1st strand cDNA synthesis kit, Takara; 6110A). RT-PCR was performed using SapphireAmp® Fast PCR Master Mix (Takara ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Neuroscience 2022Quote: ... or a rabbit anti-DsRed polyclonal antibody (1:1000, Cat # 632496, RRID:AB_10013483, Takara Bio U.S.A., Inc., CA, U.S.A.). In addition ...
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Neuroscience 2024Quote: ... They were transfected with pAAV, pAAV2/1 (Penn Vector Core, Philadelphia, PA, USA) and pHelper plasmids (Takara Bio)52 ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were incubated with a 1:2000 dilution of an anti-GFP antibody (Clontech 632381, clone JL8) for detection of Clover protein ...
-
bioRxiv - Bioengineering 2023Quote: ... KhES-1 was cultured at feeder-free conditions using StemFit® AK02N (Catalog #RCAK02N, TAKARA BIO, Kusatsu, Japan) with daily medium change ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 ng of RNA was used for the reverse transcription reaction using SMART-seq HT (Takara, 634455). For the PDO xenograft ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were first lysed in ice-cold lysis buffer (1×PBS, 0.5% sodium deoxycholate, 0.1% SDS, 0.5% NP40) with RNase inhibitor (Takara, 2313) and a protease inhibitor (Solarbio ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Genomics 2023Quote: ... 100 ng to 1 µg of total RNA was used for Hi-Mammalian whole transcriptome preparation (Takara Bio) and sequencing was performed on Nextseq2000 instrument with 1 x 72 bp single-end setup ...
-
RNA-binding protein YBX1 promotes Type H vessels dependent bone formation in an m5C-dependent mannerbioRxiv - Molecular Biology 2023Quote: ... The paraffin sections were de-waxed and stained with primary antibody OCN (#M173, Takara Bio, Japan, 1:100), and counterstained with Harris Hematoxylin.
-
bioRxiv - Genetics 2024Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the Prime Script RT kit (Takara, RR047A). The SYBR Green qPCR master mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Programed cell death was induced by incubating cells in complete DMEM with 1 mM B/B homodimerizer (Clontech) for 15 min at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were then transferred to primary antibody solution containing rabbit anti-dsRed (1:1000, Takara, Catalog #: 632496, RRID:AB_10013483) in 0.3% Triton PBS with 3% normal goat serum for 2 nights at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... the 99-1820 bp fragment of the Rat Glt-1 plasmid (GenBankTM accession number X67857.1) was subcloned between the EcoRI and Xba restriction sites of pEGFP vector (Clontech). GFP-Rab4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 g RNA was used to synthesize the cDNA using reverse transcription M-MLV (RNase-free) kits (TaKaRa, Japan). qRT-PCR was performed with SYBR green PCR master mix (ToYoBo ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was carried out with 1 μg RNA using TB Green Premix Ex Taq™ II (Takara, Japan). Targets of around 110 bp were amplified with primers qtaxB-F/R ...
-
Panacea: a hyperpromiscuous antitoxin protein domain for the neutralisation of diverse toxin domainsbioRxiv - Microbiology 2021Quote: ... Filtered lysate was incubated with 1 mL of previously buffer equilibrated Ni-beads (His60 Ni Superflow Resin, TaKaRa, Japan) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA (1 μg) was converted to cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA). Quantitative PCR (qPCR ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were washed twice with 20 mL of D-PBS (Nacalai Tesque) and resuspended in CELLBANKER 1 (Takara Bio) at 1 × 107 cells/mL ...