Labshake search
Citations for Takara Bio :
1451 - 1500 of 2431 citations for 3 5 Chloro 1H benzimidazol 2 yl propan 1 amine dihydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... About 2 μg of the isolated RNA was used to synthesize the first-strand cDNA using reverse transcriptase enzyme (Takara Bio, Clontech, USA). The cDNA was diluted seven times with sterile Milli-Q water (1:7 ratio) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transformants were selected on synthetic media containing yeast nitrogen base (YNB, Difco) supplemented with 2 % glucose and DropOut supplements lacking uracil (Clontech, Mountain View, CA). Single colonies were used to inoculate 5 mL liquid YNB media supplemented with 2 % glucose and DropOut supplements lacking uracil ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... a Tet responsive 2 promoter comprised of seven repeats of TRE binding sites and a minimal CMV promoter (based on that in Clontech’s pTRE2-hyg vector), a loxP site ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-nc82 (1:50; Developmental Studies Hybridoma Bank) and rabbit anti-RFP (1:1000; TaKaRa Bio USA, #632496) at room temperature with agitation for 2 days ...
-
bioRxiv - Cell Biology 2020Quote: The mitochondrial targeting sequence fused with the 5’-end of DsRed2 (MTS-DsRed2) was digested from the pDsRed2-Mito vector (Clontech Laboratories, Inc., Palo Alto, CA, USA) with restriction enzymes and inserted into the pMXs-puro retroviral vector (Cell Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... To detect the transgenic GFP-tagged Abl proteins we used anti-GFP (JL-8, 1:500 or 1:1000, Clontech). Anti-αTubulin (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... was verified by co-transformation of the bait (pAS2-1-APP or pAS2-1-AICD) and the prey plasmid (HB-EGF-pACT2) in the yeast strain AH109 (Clontech). First ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech, 632381 or anti-GFP.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Induction of DSBs in U2OS-DSB reporter cells line was induced by addition of Shield-1 (1 uM, TAKARA 632189) and 4-OHT (200 nM ...
-
bioRxiv - Microbiology 2021Quote: HTLV-1 viral gene expression vectors such as tax and HBZ were generated based on pIRES-EGFP (6029-1, Clontech). As a negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-ORF1p (guinea pig, 1/200, in-house, clone 09 as in 83, anti-mCherry (mouse, 1/200, Clontech 632543), rabbit anti-H3K9me3 (rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR amplified metr-1(cDNA) sequence was then fused with the linearized plasmid carrying the Prgef-1 promoter through InFusion cloning (Takara) methodology ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplification conditions were 1 µL of diluted 1/10 RT reaction with 0.05 U of PrimeSTAR GXL polymerase (Takara Bioscience), 250 nM of each primer ...
-
bioRxiv - Microbiology 2024Quote: ... using the following conditions: 1 µL of diluted 1/10 RT reaction with 0.05 µL of PrimeSTAR GXL polymerase (Takara Bioscience), 250 nM of each primer ...
-
bioRxiv - Neuroscience 2024Quote: ... The brains were then incubated with primary antibodies (anti-GFP chicken Abcam 1:1000 or 1:2000, Cat#13970; anti-dsRed rabbit Takara 1:250 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell viability was measured after 72h of treatment using the WST-1 assay (WST-1 Cell Proliferation Assay System, ref MK400, TaKaRa) according to the supplier’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Physiology 2024Quote: ... with 2 ul of RNAse inhibitor mix (containing 0.12 ul Triton X-100 10 %, 0.1 ul RNAse inhibitor (Takara (Cat. No. 2313B, 40 U/ul), 1.78 ul MilliQ water (RNAse-free)) ...
-
bioRxiv - Microbiology 2024Quote: ... the ORF4 region was amplified by RT-PCR with specific primers (Supplementary Table S2) using PrimeScript One Step RT-PCR Kit Ver.2 (Takara Bio Inc., Kusatsu, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed 1:1000 (Takara, cat# 632496). Samples were washed three times for 5 min in PBT and incubated in Alexa Fluor 488 or 594 secondary antibodies 1:500 (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-glucagon (Guinea pig 1:2500; TAKARA M182), anti-GFP (Chicken 1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Living Colors anti-DsRed (Clontech #632496, 1:100), anti-RFP (Novus Biologicals #42649) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Rabbit anti-DsRed (1:200, Takara 632496), Donkey anti-Chicken-Cy2 (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed (1:1000, Cat. # 632496, Takara Bio Europe SAS ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary rabbit anti-RFP (Clontech 632496, 1:1000) and secondary goat anti-rabbit Cy3 (Jackson 111-165-144 ...
-
bioRxiv - Plant Biology 2020Quote: ... and anti-GFP (Takara Bio, 1:5,000 dilution) antibodies with incubation for 1 h and 16 h ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (rabbit, Clontech, sc-390909, 1:500) in blocking solution overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (rabbit, Clontech, sc-390909, 1:500), anti-SYNORF1 (Synapsin ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (1:2,000, Clontech, #632496). Secondary antibodies used were goat anti-Mouse Alexa 488 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP monoclonal JL8 (1:3000, Clontech), and mouse anti-α-tubulin monoclonal DM1A (1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 1% protease inhibitor (Clontech, Mountain View, CA) and 1% phosphatase inhibitors (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1:1000, Clontech, No. 632496), rat anti-ELAV (1:30 ...
-
bioRxiv - Microbiology 2021Quote: ... or 100 ng mL-1 anhydrotetracycline (aTc) (Takara), as necessary.
-
bioRxiv - Neuroscience 2020Quote: Rabbit anti-DsRed (323496, Clontech 1:1000 dilution)
-
bioRxiv - Cell Biology 2021Quote: ... or pEGFP-N3 (Clontech, catalogue no. 6080-1) at 2.5 μg of DNA/60-mm well using Xtremegene9 (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid DNA (pEGFP-N1, 5kb (Clontech, 6085-1) encoding a cytomegalovirus (CMV ...
-
bioRxiv - Cell Biology 2022Quote: ... OCN (1:200, Takara Bio Inc, Shiga, Japan) overnight at 4°C followed by corresponding fluorescence-linked secondary antibodies (Jackson ImmunoResearch Laboratories ...