Labshake search
Citations for Takara Bio :
101 - 150 of 172 citations for Polyoxymethylene Homopolymer 20% PTFE Fiber Filled Granule since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were purified and ligated into the pMD-20 vector or the pANT vector using the Mighty TA- cloning Kit (Takara) or TA-Enhancer Cloning Kit (Nippon Gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1%Triton X) and then resuspended in lambda DNA solution (diluted to approximately 20 ng/µL in TE solution, 3010, Takara). For the Sera-Mag™ Select (29343052 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µl/well of beads were washed twice with TE solution and then resuspended in lambda DNA solution (diluted to approximately 20 ng/µL in TE solution, 3010, Takara). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... above 20% were used for downstream library generation using the SMARTer Stranded Total RNA – Pico RNA-seq kit v2 (Takara). Libraries were sequenced using 100 nucleotide paired-end sequencing on a NovaSeq 6000 (Illumina).
-
bioRxiv - Immunology 2023Quote: ... cells were resuspended in Trizol reagent and frozen at -20°C until RNA was extracted using the Macherey-Nagel Nucleospin RNA XS Kit (CAS: 740902.50, Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated with 10% blocking buffer (Nacalai Tesque, 03953-95) prepared in Tris-buffered saline/Tween 20 (Takara Bio, T9142) (TBS-T ...
-
bioRxiv - Bioengineering 2024Quote: ... the RT-PCR reaction was performed in 20 μL of reaction buffer containing 10 μL of TB green Premix Ex Taq II (RR82WR; Takara), 1 μL of 10 μM forward primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Molecular Biology 2024Quote: ... The extract was clarified by centrifugation (30min, 20 000g, 4°C) and Ss-eS26 was purified via Talon Metal affinity chromatography (Clontech). (His)6-tag was removed by thrombin digestion in buffer B containing 250 mM NaCl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... This involved mixing 100 ng of purified gene fragments with 20 ng of plasmid in a 50 μl PrimeStar HS polymerase PCR system (Cat#R010A, Takara) and following the PCR conditions ...
-
bioRxiv - Cancer Biology 2024Quote: Each PCR reaction for genotyping of Kras alleles was performed in a 20 μl mixture containing Advantage GC Polymerase (Takara), 1x GC 2 PCR Buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was dissolved in 20 μl of RNase free water and qPCR was performed using One step TB green mix (Takara).
-
bioRxiv - Genetics 2021Quote: ... was amplified from genomic DNA isolated from tail and peripheral blood using 1 µl of prepped DNA in 20 µl of PCR reaction containing 0.4 µl of PrimerStar GXL (TAKARA Bio, R050A), 4 µl of 5× Buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... for at least 20 min, followed by 5 ug/cm2 of laminin (Fisher, CB40232) resuspended in basal RHB-A medium (Takara, Y40000). After washing off this treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the supernatant was removed and the pellet was dissolved in 20 ul RNase-free H2O (Takara Bio Inc., Otsu, Shiga, Japan). Quantitation of the RNAs was performed spectrophotometrically at 260 nm ...
-
bioRxiv - Microbiology 2020Quote: ... pH 6.9 with 0.4 mg/ml cysteine and 0.135 mg/ml ferric nitrate) under inducing conditions (by adding either 20 ng/mL or 40 ng/mL anhydrous tetracycline (aTC, Clontech #631310)) ...
-
bioRxiv - Microbiology 2020Quote: ... WEAU Env-pseudotyped viruses produced by 293F were concentrated 20-fold using Lenti-X concentrator (Clontech Laboratories, Inc. Mountain View, CA). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNAs were PCR-amplified according to Takara’s SMART-Seq v4 protocol for 20 cycles using SeqAmp DNA Polymerase (Takara Bio, #638504) and a custom PCR primer ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR assay was performed using 1/20 diluted cDNA as templates in the reactions containing SYBR® Premix Ex TaqTM II (TaKaRa). The qRT-PCR assay was conducted in triplicate in an ABI 7500 Fast Real-Time PCR System ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg of the total RNA from the leaves was reverse-transcribed for 30 min at 42°C in a 20-μl reaction volume using a High Fidelity PrimeScriptTM RT-PCR kit (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... were mixed in a binding buffer (20 μL) containing 5 μL of 10×CutSmart® buffer and 1μL of RNase inhibitor (40U, Takara, Japan) and left for 10 min at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Microbiology 2022Quote: ... The resultant lysate was cleared by centrifugation at 30 000 x g for 20 min and applied to Talon CellThru Co2+ chelating resin (TaKaRa-Clontech). The protein bound resin was washed with 3 column volumes (CV ...
-
Induction of telomerase in p21-positive cells counteracts capillaries rarefaction in aging mice lungbioRxiv - Molecular Biology 2022Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in a 20 µL reaction consisting of 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; TaKaRa, Dalian, China), 1 µL each of forward and reverse primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA from two replicates of each strain were extracted at about 20 generations after refeeding using RNAiso Plus (TaKaRa, 9108).
-
bioRxiv - Developmental Biology 2024Quote: ... for 20 minutes on ice and then dispensed into the nano-well plates of the ICELL8® cx Single-Cell System (Takara). Wells containing single viable cells were automatically selected using the ICELL8 cx CellSelect v2.5 Software (Takara ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Activated T cells were transduced on day 1 after stimulation using combinations of PEG-precipitated retroviral concentrates encoding different constructs adsorbed onto non-tissue culture treated 6-well plates coated with anti-CD3/CD28 2 μg/mL each and retronectin 20 μg/mL (Takara, T100B) at 1-2×106 cells/well ...
-
bioRxiv - Microbiology 2023Quote: 0.35×105 293TT cells per plate were plated in 24-well plates 16-20 h prior to transfection of plasmids encoding HA-tagged CA Rab9a or the empty vector as control (Takara, 632105). 48 h after transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then the isolated RNA (1 μg) was reverse transcribed into cDNA (20 μL) using PrimeScript™ RT Master Mix (Perfect Real Time, Takara). The qPCR reaction was initiated at 95 °C for 3 min ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were fixed with ice-cold 4 % paraformaldehyde for 20 min and stained with rabbit anti-dsRed antibody (Takara Bio) and Alexa fluor 568-conjugated anti-rabbit secondary antibody to identify cells expressing mApple-tagged Myo6 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... anywhere between 20 to 100 ng of template per sample was used with PrimeSTAR GXL DNA Polymerase from TAKARA (Cat: R050B). The parameters for this 1st reaction were as follows ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The reaction volume of 20 µL consisted of 10 µL of TB Green Premix Ex Taq II (Tli RNase H Plus) (Takara, Japan), 0.8 µL each of gene-specific primers (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA transcribed from 0.025 μg total RNA was used per PCR reaction in a final volume of 20 μl with TB Green Premix Ex Taq II (#RR820A, Takara Bio). PCR was performed using a Biorad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Cancer Biology 2024Quote: ... Digested chromatin was allowed to diffuse out of cells at 37 °C for 20 min and DNA was purified by Nucleospin gel and PCR clean-up spin column (Takara bio). Sequencing libraries were prepared using the KAPA HTP Library Preparation Kit (KAPA Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... qRT-PCR assays were conducted in a 20 μL reaction volume employing TB Green Premix Ex TaqTM (Tli RNaseH Plus) (Takara, Japan). GAPDH served as the internal control ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleolar-fraction DNA (NF-DNA) and the control whole-cell DNA (WC-DNA) were extracted using NucleoBond AGX-20 columns (Takara # 740544) and NucleoBond® Buffer Set III (Takara # 740603) ...
-
bioRxiv - Neuroscience 2021Quote: ... The supernatant was removed and the cell pellet re-suspended with a 20 µL mix containing: 1X of the 5X PrimeSTAR GXL Buffer (Clontech, Takara Bio Europe), proteinase K (0.167 mg/mL ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... 86% of 2% Tween 20 in deionized Water) or AP20187 (B/B homodimerizer, Clontech; 10 mg of AP20187 per kg body mass) twice weekly at the age of 20 months for a total of 4 months (old mice were sacrificed at 24 months of age) ...
-
bioRxiv - Plant Biology 2021Quote: ... Recombinant proteins were induced by 1 mM IPTG at 16°C for 20 h, then purified by a GST-tag Protein Purification Kit (Beyotime, Shanghai, China) or His TALON Purification Kit (Takara, Beijing, China). Corresponding primers are listed in Supplemental Table S2.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... served as template in a 20 μl qRT-PCR using the TB Green Premix Ex Taq II (Tli RNaseH Plus) kit (Takara Bio Inc.) and the Roche LightCycler 96 system (Roche ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized to a total of 500ng RNA in a 20 μL system using PrimeScript™ RT Reagent kit (TAKARA, #RR036A). q-PCR were performed on anlytik jena (qTOWER 2.0 ...
-
bioRxiv - Genetics 2022Quote: ... was reverse-transcribed into the first-strand cDNA in a 20 μl reaction volume using the first strand cDNA synthesis Kit (TaKaRa, Dalian, China). PCR amplification were 94℃ for 3 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.5 µl used as a source of genomic DNA in 20 µl PCR reactions with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Genomics 2024Quote: ... filtered retroviral supernatants were harvested and applied to HSCs (extracted as described above) in plates coated with Retronectin (20 μg/ml; Takara Bio; #T100B). The transduction process involved spinning at 2,000g for 2 hours at 32°C ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 µl reaction mixtures comprising 10 µl of 2×TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Cat#RR420A, TaKaRa), 1 µl of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA was submitted to sequencing (∼20 million PE reads) via library preparation using the ThruPLEX library preparation kit (Takara, Shiga, Japan), and 150 bp PE sequencing on the Illumina NovaSeq platform (see chapter “Sequencing strategies”).
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.5 μl used as a source of genomic DNA in 20 μl PCRs with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). The amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...