Labshake search
Citations for Takara Bio :
101 - 150 of 674 citations for P N Nonylphenol Diethoxylate Ring 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Developmental Biology 2020Quote: ... Living Colors anti-DsRed (Clontech #632496, 1:100), anti-RFP (Novus Biologicals #42649) ...
-
bioRxiv - Developmental Biology 2019Quote: ... mCherry (Takara Bio or Novus Biologicals, 1:100). For Snail/Dach double immunostaining ...
-
bioRxiv - Developmental Biology 2021Quote: ... to detect mOrange (rabbit, Clontech 632496, 1:100). The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... the sequence of NAGTI-GFP (N-acetylglucosaminyltransferase I fused to GFP; (Shima et al., 1997)) was cloned into pLVX-TetOne-Puro (Clontech). The constructed plasmid was then co-transfected with psPAX and pVSVG into HEK293T cells to produce lenti-viruses ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x) ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2021Quote: ... an additional set of genes encoding pTF.CREG1 with N-terminal truncations (Δ26, Δ31, Δ39, Δ43) was generated by PCR using PrimeStar GXL DNA Polymerase (Takara Bio), primer sets JT33/JT32 ...
-
bioRxiv - Biophysics 2021Quote: ... AY457063.1) and PIKfyve-KYA hyperactive mutant (E1620>K, N1630>Y, S2068>A) were cloned into PCMV-HA-N vector (Clontech) and gifted by Lois Weisman lab ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... A plasmid expressing mouse GR tagged in the N-terminus with mCherry was developed by amplifying mouse GR coding sequence and in-frame cloning in pmCherry-C3 (Clontech). Point mutations and deletions were introduced using the Quickchange XL mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Cancer Biology 2024Quote: ... were subcloned and fused with the CD8 signal peptide sequence (MALPVTALLLPLALLLHAA) followed by a Myc-tag at the N-terminus in pIRESpuro3 (Clontech). Humanized EREG mAbs H231 and H206 (23 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Genomics 2020Quote: ... with a flag tag at the N terminal and an EGFP tag at the C terminal by the In-Fusion HD Cloning system (TaKaRa, 638909). After transfection of the U2OS cells with the pCMV-Tet3G Vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full-length WDR5 was cloned in frame as N- or C-terminal NanoLuc-fusion pNLF1 vector using ligation independent in-fusion cloning (Takara Bio) and sequence verified ...
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Genetics 2020Quote: ... The amplified fragment was cloned into the AscI site of pBM61::CCGp-N-3xFLAG (80) by InFusion cloning (Takara, cat. # 639648). The new plasmid was then digested with DraI and transformed into a his-3;mus-52::bar strain ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Cell Biology 2022Quote: ... ACLY lentivirus constructs were generated by inserting ACLY variants with an N-terminal MYC tag into pLVX-IRES-Puro (Clontech, 632183). All DNA constructs were verified by Sanger sequencing.
-
bioRxiv - Microbiology 2024Quote: B263R was amplified from gDNA of ASFV and cloned separately into vectors pCMV-Flag-N (635688; Clontech, Mountain View, CA, USA), pCMV-Myc-N (635689 ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid was used to generate N-terminal-truncated MGME1 (ΔN-MGME1; residues 95 to 344) by means of In-Fusion Cloning (Takara Bio). Constructs expressing the MGME1 variants used in this study were generated by site-directed mutagenesis using the pSol-His8-SUMO-MGME1 plasmid as template ...
-
bioRxiv - Biochemistry 2023Quote: ... 425 – 658) and SipAC-Core (a.a. 512 – 658) were cloned with an N-terminal 6xHis-tag into pColdI vector (Takara Bio USA) modified to include a tobacco etch virus (TEV ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... Rapamycin analogue linker drug (AP21967, Clontech, 100 nM, 3hrs), SAR405 (Millipore Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-dsRed dilution 1:100 (IF) (Clontech, 632496); mouse anti-M6PR dilution 1:100 (IF ...