Labshake search
Citations for Takara Bio :
101 - 124 of 124 citations for N Acetyl methyl amino dimethylsilyl N methylacetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
bioRxiv - Microbiology 2024Quote: ... Dropout medium and plates were prepared with DifcoTM Yeast Nitrogen Base without Amino Acid (Becton Dickinson) and DO supplements (Clontech) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... two to three amino acids in GFP-SP-BAP were replaced by alanine for each construct using the CloneAmp HiFi PCR Premix (Takara Bio) according to the manufacturer.
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Immunology 2023Quote: ... The expression vectors for the S variants with multiple amino acid changes or deletions were generated using the In-Fusion HD cloning kit (Takara Bio). The pcDNA3.1-hACE2 used to express human ACE2 (hACE2 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...