Labshake search
Citations for Takara Bio :
101 - 150 of 5257 citations for Human E3 Ubiquitin Protein Ligase SMURF2 SMURF2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Illumina data from human HEK293T cells were processed with the SMARTer® smRNA-Seq Kit for Illumina (Takara, Cat. Nos. 635029) following guidelines ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Biochemistry 2021Quote: The R3C ligase construct10 was cloned into the pRZ plasmid71 using the InFusion cloning system (Takara Bio, Japan). To ensure correct length of the transcript ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Microbiology 2019Quote: Human fetal NSCs were purchased from Clontech (human neural cortex ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: Human foreskin fibroblasts BJ-hTERT cells (Clontech) were grown in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ligation of a polyT-extruding adaptor (Sangon Ltd., China) was performed with E.coli ligase (Cat. #2161, Takara Ltd., Japan). Linear amplification of the ligated product was performed with adaptor-specific primer (Sangon Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... and a U2 adapter was ligated to each dsRNA fragment using T4 RNA ligase (Takara Bio Inc., Kusatsu, Japan). After denaturing the product ...
-
bioRxiv - Biophysics 2019Quote: A cDNA encoding human DBNL was amplified by PCR from Human Brain Whole QUICK-Clone™ cDNA (Clontech Laboratories) using the primers ...
-
bioRxiv - Genomics 2021Quote: U2OS (human bone osteosarcoma epithelial, female, ATCC HTB-96) and LentiX 293T (human embroyonic kidney epithelial, female, Takara 632180) cells were cultured in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Developmental Biology 2019Quote: ... Annealed oligonucleotides were ligated into pGP-U6 (GenePharma, Shanghai, China) between the Bbs and Xho sites by T4 DNA ligase (TaKaRa) to produce pGP-U6-Mis-shRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The gRNAs used in this study were synthesized and inserted at BsaI site of pDC expressing vectors using T4 ligase (2011A, Takara). For dual sgRNA system ...
-
bioRxiv - Microbiology 2022Quote: ... The Kpn I – BamHI env fragments from the pSVIIIenv plasmids were cloned into the corresponding sites of pE7SB-NL4-3 using Long Ligase (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: The PCR products (3.2 kb or 2.0 kb of HBV-DNA if the 3.2-kb DNA was unavailable) were cloned into the vector PMD-19T with T4 DNA Ligase (Takara, Japan) and transformed into TOP10 Escherichia coli competent cells (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... between the pU6 promoter and sgRNA scaffold via Bsa I digestion and T4 DNA ligase-mediated ligation (Takara, cat. 6023). For oligonucleotide-dependent mutation knock-in ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Biochemistry 2022Quote: ... Human DOCK10 DNA was synthesized by Clontech (NM_014689). The DHR2 domain of human DOCK11 DNA (NM_144658.3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...