Labshake search
Citations for Takara Bio :
101 - 150 of 2064 citations for 7 8 Dihydro 6H 1 6naphthyridin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-GFP JL-8 (cat. no. 632381, Takara) used at a concentration of 1:2,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Protamine sulfate (Final concentration: 8 μg/ml, Takara Bio) was added ...
-
bioRxiv - Molecular Biology 2021Quote: ... The One-step PrimeScript miRNA cDNA Synthesis Kit (Takara, Japan) was utilized for reverse transcription ...
-
bioRxiv - Systems Biology 2019Quote: ... Lenti-X™ Tet-One™ Inducible Expression System (Clontech) was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...
-
bioRxiv - Plant Biology 2021Quote: ... transferred to PVDF membranes by Western blotting and visualized with anti-GFP (JL-8 Takara Bio Clontech, Lot #A8034133, 1:5000), anti-α-tubulin (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... transferred to PVDF membranes by Western blotting and visualized with anti-GFP (JL-8 Takara Bio Clontech, Lot #A8034133, 1:5000), anti-α-tubulin (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Pathology 2020Quote: The viral loads of WHCV in BALF of patient 1 were determined by quantitative real-time RT-PCR with Takara One Step PrimeScript™ RT-PCR Kit (Takara RR064A) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... mRNA was isolated using PrepX PolyA-8 protocol (Takara 640098). The mRNA samples were then processed for cDNA preparation using PrepX mRNA-8 (Takara 640096 ...
-
bioRxiv - Genetics 2020Quote: Custom oligonucleotides containing 8-OHdG bases were purchased from Takara Bio Inc ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Cell Biology 2019Quote: ... for 30 min at 37°C in a moisture chamber followed by an incubation with anti-GFP (1:100 in PBSA) antibody at 4°C for 72 h (Takara 632381/JL-8)) ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with relevant siRNA were seeded on to 8–well chamber slides and treated with 1 μM Sheild1 (632189, Clontech Laboratories UK Ltd) and 1 μM 4–hydroxytamoxifen (4–OHT ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Cell Biology 2021Quote: ... JL-8 anti-GFP monoclonal antibody (TaKaRa, catalog # 632381, lot # A8034133) at 1:2,000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-CHS (sc-12620 ...
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Genomics 2022Quote: ... 16 µL 100x DAPI and 8 µL ICELL8 Second Diluent (Takara) were added and incubated 10 minutes at RT ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-GFP clone JL-8 (Takara Bio Cat# 632380, RRID:AB_10013427), rabbit anti-FLAG clone D6W5B (Cell Signaling Technology Cat# 14793 ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-HY5 (Oravecz et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...
-
bioRxiv - Molecular Biology 2022Quote: ... GFP expression was verified using immunoblotting using GFP (JL-8-Clontech) and α-tubulin (CP06 Calbiochem ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were then incubated with anti-GFP antibody (JL-8; Clontech) at a dilution of 1:5,000 ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP expression was verified using immunoblotting using GFP (JL-8, Clontech) and α-tubulin (CP06 ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2021Quote: ... Monoclonal GFP antibodies (clone JL-8; lot# A5033481-A) were from Clontech Takara Bio (San Jose ...
-
bioRxiv - Cell Biology 2020Quote: ... Then the slides were incubated with anti-GFP (Takara 632381/JL-8)) (1:100 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Plant Biology 2022Quote: ... Blots were probed with anti-GFP monoclonal antibody JL-8 (632381, Clontech) diluted at 1/3000 in 1X PBS containing 0.1% Tween-20 and 5% non-fat milk ...