Labshake search
Citations for Takara Bio :
101 - 150 of 2205 citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 U RNAse inhibitor (Takara, 2313A), 10mM dNTPs (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... fixed for 1 h in 4% paraformaldehyde/PBS (TAKARA BIO INC. Cat#T900), and subjected to antibody labeling ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the mouse monoclonal anti-GFP (Jl-8, Clontech; 1:500 overnight at 4°C) primary antibody was used ...
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were prepared from <=2.5ng input RNA using 1/4 volume SmartSeqv4 technology (Takara Bio) and sequenced on NextSeq High Output flow cells ...
-
bioRxiv - Genomics 2020Quote: ... corresponding primers (Supplementary Table 3-4), Phanta Max Super-fidelity DNA Polymerase (Cat. No. P505-d1, Vazyme) or KOD plus (Cat. No. F0934K, Takara, Kyoto, Japan) with a touchdown cycling protocol that contains 30 cycles of 98 °C for 10 s ...
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...