Labshake search
Citations for Takara Bio :
101 - 150 of 633 citations for 6 2 Ethoxyphenyl 6 oxohexanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...
-
bioRxiv - Neuroscience 2024Quote: ... Doxycycline (2 µg/ml, Clontech) was added on day 0 to induce TetO gene expression and retained in the medium until the end of the experiment ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Immunology 2024Quote: ... version 2 (Takara cat. no. 634411). After sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg/mL doxycycline (Clontech, 631311), 0.5 mM lysine ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/mL doxycycline (Clontech, 631311)) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/mL doxycycline (Clontech, 631311)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-X Concentrator (Takara Bio PT4421-2) was added at a 1:3 volume ratio with clarified supernatant (1 part Lenti-X Concentration ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/ml doxycycline (Clontech, 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acids were then extracted using the NucleoSpin Gel and PCR Clean-up XS Kit (Takara Bio 740611.250).
-
bioRxiv - Neuroscience 2020Quote: ... Samples were FACS-sorted on a Becton Dickinson FACS Aria cell sorter gating for DAPI−/DRAQ5+/GFP+ cells directly collected in 100 μl of RA1 lysis buffer with 2 μl tris(2-carboxyethyl)phosphine (TCEP) from NucleoSpin RNA XS kit (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Pathology 2024Quote: ... ENTV-1 and ENTV-2 were amplified by PCR (Table 2) using the high-fidelity DNA polymerase “PrimeStar GXL” (Takara), with primers targeting exogenous β-retroviruses ...
-
bioRxiv - Plant Biology 2021Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.5 μL Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 2 µg/ml doxycycline (Clontech, 631311) for 3 days prior to electroporation and to induce Cas9 nickase expression ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of T7 Enzyme Mix (TaKaRa). This was adjusted to 30 μL with nuclease-free ddH2O before incubating the mixture at 42°C for 2 h ...