Labshake search
Citations for Takara Bio :
101 - 150 of 988 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVX-Tet-One-Puro vector (Clontech, #631847), encoding for an engineered Tet activator and the corresponding inducible promoter ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... one treated with 250 nM rapalog (Clontech) at ring stage ...
-
bioRxiv - Microbiology 2024Quote: ... the ORF4 region was amplified by RT-PCR with specific primers (Supplementary Table S2) using PrimeScript One Step RT-PCR Kit Ver.2 (Takara Bio Inc., Kusatsu, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Yeast one-hybridization assay was performed using the Matchmaker® Gold Yeast One-Hybrid System (Clontech, Palo Alto, CA, USA). The promoter sequence (upstream 2kb from the start codon ...
-
bioRxiv - Cell Biology 2021Quote: ... One microgramme of total RNA was reverse-transcribed using a One Step PrimeScript™ RT-PCR Kit (Takara, Liaoning, China) with a thermocycler ...
-
bioRxiv - Molecular Biology 2021Quote: ... One-step PrimeScript miRNA cDNA Synthesis Kit (Takara) was applied for reverse transcription ...
-
bioRxiv - Microbiology 2020Quote: ... One-Step PrimeScript RT-PCR Kit (Takara, RR064) was utilized for qRT-PCR (probe ...
-
bioRxiv - Genetics 2023Quote: ... Then One-step PrimeScript RT-PCR kit (Takara) was used to generate cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... One-third volume of Lenti-X concentrator (Takara) was added to the cell culture medium and incubated overnight at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA from SARS-CoV-2 infected lung or trachea was subjected to one-step real-time reverse transcription PCR using One-step PrimeScript RT-PCR kit (Takara, RR064B). Multiplex PCR was performed to detect SARS-CoV-2 nucleocapsid gene and mouse Actb gene ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... was cloned into pLVX Tet-One Puro plasmid (Clontech), packaged in 293T cells (from ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of PrimeScript One Step Enzyme Mix (TaKaRa), 10 μL of 2× One Step RT-PCR buffer (TaKaRa) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of extracted RNA was subjected to one-step real-time RT-PCR using a One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.) on a QuantStudio 5 Real-Time PCR system (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The extracted RNAs were subjected to one-step real-time PCR using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.).
-
bioRxiv - Plant Biology 2023Quote: ... The yeast two-hybrid and one-to-one confirmation experiments were performed according to Matchmaker™ Gold Yeast Two-Hybrid System User Manual (Clontech, https://www.clontech.com/). Primers for vector construction were listed in Table S8.
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The One-step PrimeScript miRNA cDNA Synthesis Kit (Takara, Japan) was utilized for reverse transcription ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Plant Biology 2024Quote: The Gold Yeast One-Hybrid Library Screening System (#630491; Takara, Shiga, Japan) was used for screening RSRE motif binding proteins ...
-
bioRxiv - Microbiology 2024Quote: ... with the One Step PrimeScript™ RT-PCR Kit (Takara Bio, RR064A). The following primers targeting a 244-base amplicon of the IAV M segment were used:
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed using One Step SYBR PrimeScript RT-PCR kit (Takara Bio) on a 7900HT real-time system (Applied Biosystems).
-
bioRxiv - Immunology 2021Quote: ... utilizing the PrimeScript™ One-Step RT-PCR kit (Takara Bio, Shiga, Japan). PCR products were then separated and visualized by agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized using the one-step PrimeScript RT-PCR Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... A One Step SYBR® PrimeScript™ qPCR kit (TaKaRa Bio, Otsu, Japan) was used to synthesize cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2022Quote: ... was performed with one-step Prime script III RT-qPCR mix (Takara, Japan). The viral RNA of NP was detected by 2019-nCoV-N1 probe (Cat#10006770 ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram of total RNA and the PrimeScript RT reagent kit (Takara Bio.) were used to perform the first-strand cDNA synthesis ...
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of cDNA was added to the PCR-reaction premix (Takara Bio) with 10 pM corresponding primer pairs ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR was carried out using the One Step RNA PCR Kit (TaKaRa Biotechnology Dalian ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...