Labshake search
Citations for Takara Bio :
101 - 150 of 1390 citations for 2' 4' Dichloro 3 2 5 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2024Quote: ... version 2 (Takara cat. no. 634411). After sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg/mL doxycycline (Clontech, 631311), 0.5 mM lysine ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Microbiology 2024Quote: ... was used to determine 5’ and 3’ terminal nucleotide sequences of PcAEV4 and PcAEV5 with the SMARTer® RACE 5’/3’ Kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 21 bp barcodes were amplified with 5’-GGGATCACTCTCGGCATGG-3’ forward and 5’-CTGATCAGCGAGCTCTAGGAA-3’ reverse primers and PrimeSTAR GXL DNA polymerase (Takara Bio, Shiga, Japan). They were then sequenced with NextSeq 500 1×150 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus-containing supernatant was harvested on days 2 and 3 after transfection and then concentrated using a Lenti-X concentrator (Clontech, 631232). HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed in a 10 µL reaction volume containing 5 µL of 2× SYBR Premix Ex Taq (RR420A, Takara), 1 µL of diluted cDNA ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-X Concentrator (Takara Bio PT4421-2) was added at a 1:3 volume ratio with clarified supernatant (1 part Lenti-X Concentration ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/ml doxycycline (Clontech, 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/mL doxycycline (Clontech, 631311)) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/mL doxycycline (Clontech, 631311)) ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of cDNA was used together with specific forward and reverse primers for primary miR-43093 (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ RACE was carried out using SMARTer RACE 5′/3′ Kit (Takara Bio USA, Mountain View, CA) to identify the transcription start site (TSS ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...