Labshake search
Citations for Takara Bio :
101 - 150 of 2495 citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-3-3τ and β-actin were designed and synthesized by Takara (Table 1). To run the real-time PCR reaction ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatants were harvested and mixed 1 to 3 with Lenti-X concentrator (Takara, 631232), cooled down to 4C for 30 minutes and spun down for 45 minutes at 4C.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus-containing supernatant was harvested on days 2 and 3 after transfection and then concentrated using a Lenti-X concentrator (Clontech, 631232). HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... T cells were incubated at 3×104 cells/well in 96-well U bottom plates for 24 hours in T cell media containing 50 IU/mL rhIL-2 and varying concentrations of AP20187 (B/B homodimerizer, Takara, 635058). After 24 hours ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ RACE was carried out using SMARTer RACE 5′/3′ Kit (Takara Bio USA, Mountain View, CA) to identify the transcription start site (TSS ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Molecular Biology 2020Quote: ... Confirmatory “1-to-1” pairwise assays for selected interactants were performed with the MatchMaker Two-Hybrid System 3 (Clontech Inc.)
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of cDNA was used together with specific forward and reverse primers for primary miR-43093 (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Pathology 2024Quote: ... ENTV-1 and ENTV-2 were amplified by PCR (Table 2) using the high-fidelity DNA polymerase “PrimeStar GXL” (Takara), with primers targeting exogenous β-retroviruses ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... 86% of 2% Tween 20 in deionized Water) or AP20187 (B/B homodimerizer, Clontech; 10 mg of AP20187 per kg body mass) twice weekly at the age of 20 months for a total of 4 months (old mice were sacrificed at 24 months of age) ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were cloned using the SMARTer RACE 5’/3’ Kit (Takara, Cat No. 634858) and then sequenced (Beijing Genomics Institution ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... which was performed using a SMARTer RACE 5’/3’ Kit (Clontech Laboratories, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat monoclonal anti-E-cadherin antibody (ECCD-2) (1:200) (Takara, Cat# M108), mouse monoclonal anti-Yap1 antibody (MO1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...