Labshake search
Citations for Takara Bio :
1401 - 1450 of 2621 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... A total of 5 μg of RNA were reverse transcribed and amplified using One Step SYBR Prime-Script PLUS RT-PCR Kit (TaKaRa) and the Thermal Cycler Dice instrument (TaKaRa ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was pre-amplified by adding 2 uL of cDNA from each sample to 8 uL of preamp master mix [5 uL TaKaRa premix Taq polymerase (Clontech), 2.5 uL 0.2X Taqman pooled probe ...
-
bioRxiv - Genomics 2020Quote: ... The resulting plasmids were digested with Kpn1 and Xho1 at the multiple cloning site of the vector and serially deleted from the XhoI cutting site (5’-protruding end) by treating the plasmids with exonuclease III and mung bean nuclease (Takara) for fixed times ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... or pBR_NL4-3 92TH014.12 IRES eGFP (R5 tropic) [81] (a kind gift from Frank Kirchhoff, Ulm University, Germany) and VSV-G envelope encoding plasmid (PT3343-5, Clontech). 293T cell supernatants were collected 3 days post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... The precipitated material was removed by centrifugation and the soluble fraction was loaded onto a column (5 mL) containing Talon affinity resin (Clontech) equilibrated in buffer A ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 million cells were electroporated with 5 µg of plasmids encoding tested lncRNAs or with of the pEGFP-N3 reporter vector (Clontech) as previously described 30 ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Microbiology 2022Quote: Sequence of the human variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the RNA was concentrated and reverse transcribed with a 5’-RACE protocol that appends a new primer site to the cDNA of both cleaved and uncleaved RNA (SMARTScribe, Takara). The cDNA was PCR amplified with primers that add the adaptors for Illumina sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: Rps29 5’UTR and coding region cDNAs were synthesised using SMART™ RACE cDNA Amplification Kit (Clontech Laboratories Inc. USA). PCR was performed using gene-specific primers (40S 5’ RACE R ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was then added to the supernatant to a final concentration of 5 mM and the solution was subjected to immobilized metal affinity chromatography (IMAC) by incubation with TALON cobalt resin (Takara) for 1 hr at 4°C ...
-
bioRxiv - Biophysics 2020Quote: ... containing either tetra-acetylated or unmodified histone H4 was digested for 5 min at 22 °C with micrococcal nuclease (MNase) (0.125 to 2.0 units; Takara, cat. #2910A) in 5.5 mM Tris-HCl buffer (pH 7.6 ...
-
bioRxiv - Genetics 2021Quote: ... The fragment length of PCR products was detected by 1.2% agarose gel electrophoresis using 5 μl of 100 bp DNA Ladder (TaKaRa, Japan) and gel stain (TransGen Biotech ...
-
bioRxiv - Microbiology 2023Quote: ... iBMDMs were seeded into 24-well plates (5×104 cells/well) and transfected with 600 ng and 1200 ng of the eukaryotic expression vector (pCMV-HA; Clontech) harbouring TcpB for 24-hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... the NaCl concentration of the cleared lysate was adjusted to 500 mM and the cleared lysate was applied to 10 mL (=5 mL bed volume) equilibrated Talon SuperFlow Metal Affinity Resin (TaKaRa) per L culture on ice for 45 min ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for RNA sequencing were prepared from 5 ng RNA/sample using the SMARTer Stranded Total RNA-Seq Kit v2 -Pico Input Mammalian (Takara) according to the manufacturer’s instructions using 12 PCR cycles for amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted to 1 µg/mL with Milli-Q ultra-pure water for 5 min at room temperature or with a pollen germination medium containing 2000-fold SYBR Green I (Cat#: 5760A, Takara) and 5 µg/mL DAPI (Cat# 10236276001 ...
-
bioRxiv - Microbiology 2023Quote: Sequence of the mouse variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio, USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma based on isotype ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment coding GFP was inserted at the 5’ side of SYP32 by In-Fusion HD Cloning Kit (Takara), and the whole sequence was recombined into pGWB1 by LR Clonase II ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR purified integrin β5 with engineered flanking restriction sites (Xho-I/BamHI) was subcloned into the multi-cloning sites of pEGFP-N1 (Clontech) to encode an in-frame fusion protein with the carboxy-terminal EGFP-tag (pEGFP-N1-Integrin β5 ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA samples (5 ng) were used as templates in 20 μl reactions performed with PrimeSTAR GXL DNA Polymerase (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Transferred membranes were blocked with 5% (w/v) milk for 30 mins at RT before being hybridized with the corresponding anti-GFP (632381, Takara) or anti-mCherry (632543 ...
-
bioRxiv - Cell Biology 2023Quote: ... Up to 5 μl of assembly reactions were used for heat-shock transformation of Stellar™ Competent Cells (Takara Bio).
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... BBQ and FICZ as indicated at 37°C in 96-well plates for 5 days prior to measuring viability using WST reagent (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were generated from 5 ng of RNA with the SMART-Seq v4 Ultra Low Input RNA Kit from Takara Bio (#634889 ...
-
bioRxiv - Immunology 2024Quote: ... total RNA (0.5 ng) was added to reaction buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full length amplified cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Immunology 2024Quote: ... The individual 25 µl volume 5’RACE PCR reactions were then carried out in 96-well plates using the thermocycler program recommended by the 5’RACE kit (Takara), with 35 cycles of gene-specific amplification with an annealing temperature of 60°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... BAC DNA or hL1-5’_3.3kb plasmids were purified using the NucleoBond® Xtra Midi Plus EF kit (Takara # 740422.50) following instructions for low-copy or high-copy plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... TEX12 (1-123) and SIX6OS1 (1-587) were cloned into pGADT7 vectors (Clontech). The Matchmaker™ Gold system (Clontech ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated twice in 1 ml of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... then in 1:25,000 or 1:100,000 rabbit anti DSRed (Takara Bio USA) in 10% NHS-TPBS ...
-
bioRxiv - Physiology 2024Quote: ... (Cx43: 1:3000 custom-produced rabbit polyclonal; eGFP: 1:1000 mouse monoclonal (Clontech Laboratories Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and 50 ng mL−1 or 25 ng mL−1 anhydrotetracycline (aTc, Clontech) and Aeromonas sp ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Purified RNA served as input for the cDNA library preparation with SMART-Seq v.4 Ultra Low Input RNA kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was carried out using a Chromo 4 detector (CFB-3240, MJ Research) and the SYBR Premix Ex Taq™ (Takara Bio Inc.) for ap or the THUNDERBIRD SYBR qPCR Mix (QPS-201 ...
-
bioRxiv - Cell Biology 2023Quote: ... MT-4 cells (gift from(Nakashima et al., 1990) were transfected with a plasmid containing LTR-driven EGFP expression plasmid (Clontech Laboratories Inc, USA) and pFX2 (Invitrogen Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... for at least 20 min, followed by 5 ug/cm2 of laminin (Fisher, CB40232) resuspended in basal RHB-A medium (Takara, Y40000). After washing off this treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... subsequently placed in a line in the electrode gap filled with 5 μl the mixture of 120 ng/μl Cas9 protein (TaKaRa, Japan), 300 ng/μl tracerRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... The single strand cDNA for 5’RACE was prepared by in vitro reverse transcription with avian myeloblastosis virus reverse transcriptase XL (Takara Bio) using total RNA (0.5 µg ...
-
bioRxiv - Pathology 2022Quote: ... 5 ng of total RNA was used with the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (TAKARA, Japan), according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... Tcrb amplicons were prepared using a 5’RACE-based protocol with the SMARTer Mouse TCR α/β Profiling Kit (Takara #634402) following the manufacturer’s instructions ...