Labshake search
Citations for Takara Bio :
1401 - 1450 of 1766 citations for 1 1 Ethynylcyclohexyl azetidin 1 ium 3 yl n naphthalen 1 ylcarbamatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The 21 bp barcodes were amplified with 5’-GGGATCACTCTCGGCATGG-3’ forward and 5’-CTGATCAGCGAGCTCTAGGAA-3’ reverse primers and PrimeSTAR GXL DNA polymerase (Takara Bio, Shiga, Japan). They were then sequenced with NextSeq 500 1×150 (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... The respective PCR products were then cloned into pcDNA5_FRT_TO_3xFlag(N) using In-Fusion® HD Cloning Kit (Cat. No. 639650, Takara).
-
bioRxiv - Cell Biology 2020Quote: ... A murine Sox21 cDNA with a N-terminal myc epitope was subcloned in a modified pTRE-Tight (Clontech) vector (pTT::myc-sox21) ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Cancer Biology 2024Quote: CDC20 (NM_001255.3) or CDC20 with an N-terminal 3xFlag tag were cloned in the pLVX IRES Hygro vector (Clontech). The CDC20 R445Q mutation were generated using site directed mutagenesis (Pfu polymerase) ...
-
bioRxiv - Biochemistry 2024Quote: ... as an in-frame fusion with a TEV protease-cleavable N-terminal GST tag using InFusion cloning (Takara). For SPR studies ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the wild-type CARD14 insert with N-terminal 3xFLAG tag was cloned into pBApo-EFalpha Pur DNA (Takara Bio) whose EF-1α promoter was replaced by TRE3G promoter obtained from pTRE3G (Clontech) ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Plant Biology 2022Quote: ... the N-terminal part is subject to self-activation in yeast64) inserted into pDONR221 were recombined into pGBKT7 (Clontech) to obtain BD- RGA ...
-
bioRxiv - Biochemistry 2022Quote: ... N-terminal Flag-tagged P38α containing 3C protease site was amplified by PCR using CloneAmp HiFi PCR Premix (Takara) and ligated in to pcDNA3 using the aforementioned restrictions sites ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... red fluorescence protein (DsRed) and NK-NT or NKN1 fragments were cloned into pET6xHN-N Vector (Takara, CA, USA). HEK293T cells were cultured in FP medium (DMEM containing 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... or into pHTN-HaloTag vector for GID4-HaloTag N-terminal fusion using the In-Fusion HD Cloning kit (Takara). Pro/N-degron coding sequence was cloned into pNLF1-C for MPGLWKS-NanoLuc C-terminal fusion ...
-
bioRxiv - Neuroscience 2024Quote: ... DLK and DRP1 were N-terminally tagged into a GST-containing backbone using In-fusion cloning (Takara Bio. 638945). Cyto-mAPPLE plasmid was a gift from Michael E ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Cell Biology 2020Quote: ... the sequence of NAGTI-GFP (N-acetylglucosaminyltransferase I fused to GFP; (Shima et al., 1997)) was cloned into pLVX-TetOne-Puro (Clontech). The constructed plasmid was then co-transfected with psPAX and pVSVG into HEK293T cells to produce lenti-viruses ...
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x) ...
-
bioRxiv - Cell Biology 2021Quote: ... an additional set of genes encoding pTF.CREG1 with N-terminal truncations (Δ26, Δ31, Δ39, Δ43) was generated by PCR using PrimeStar GXL DNA Polymerase (Takara Bio), primer sets JT33/JT32 ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Biophysics 2023Quote: ... A plasmid expressing mouse GR tagged in the N-terminus with mCherry was developed by amplifying mouse GR coding sequence and in-frame cloning in pmCherry-C3 (Clontech). Point mutations and deletions were introduced using the Quickchange XL mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Neuroscience 2024Quote: ... and a single transmembrane region from human IL2RA (UniProt accession number: P01589) were fused to the N-terminus of KCNQ2 or KCNQ3 using the In-Fusion HD Cloning Kit (Takara). Site-directed mutations were introduced into KCNQ2 and KCNQ3 by standard PCR techniques using PrimeSTAR Max DNA Polymerase (Takara) ...
-
bioRxiv - Cell Biology 2024Quote: ... full-length IQGAP1 was tagged at the N terminus with tandem enhanced green fluorescent protein (EGFP) and inserted into pEGFP-C1 (Clontech) at a BglII and SmalI site ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...