Labshake search
Citations for Takara Bio :
1351 - 1400 of 5247 citations for Rat Large Proline Rich Protein BAG6 BAG6 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Takara BioProduct) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Genomics 2020Quote: ... and RNA-seq libraries generated using the SMARTer cDNA synthesis kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... All PCR products were inserted using the In-Fusion cloning kit (Clontech) into the pBMDEL which had been linearized with BfuAI ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All cloning procedures were performed using the in-fusion cloning kit (Clontech).
-
bioRxiv - Genomics 2019Quote: ... Reverse transcription was performed with a PrimeScript RT-PCR Kit (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and PCR analyzed with primers chd-RT-F and chd-RT-R (Table 1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated using the In-Fusion® HD cloning kit (Takara Bio) according to manufacturer’s instructions or were purchased (Addgene) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription was performed with the PrimeScript RT reagent kit (RR037A, TaKaRa).
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Genomics 2020Quote: ... and reverse transcribed using PrimeScriptⅡ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The sequence of the LFY gene was amplified by PCR in 50-µL reaction mixture by using TaKaRa Ex Taq Hot Start Version (TaKaRa Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAseq library was prepared by DNA SMART ChIP Seq Kit (TAKARA #101617). RNA Sequencing was performed on Illumina NextSeq 500 desktop Next Generation Sequencing (NGS ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified sequences were inserted using InFusion (InFusion HD Cloning kit, Clontech). Plasmid constructs were injected into one-cell zygotes and integrated into the genome via Ac-mediated recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... The transgene plasmid was generated using the InFusion HD Kit (Clontech, 638910) and the NucleoBond Xtra Midi EF Kit (Macherey-Nagel ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA sequencing libraries were prepared using a SmartSeq HT kit (Takara Bio) and Illumina Nextera XT kit (Illumina Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and inserted into the pFastBac vector using In-Fusion kit (TaKaRa # 638910). Inserts encoding wild-type or mutant Myo1e fragments (motor domain + IQ motif ...
-
bioRxiv - Genomics 2021Quote: ... by calcium phosphate transfection with CalPhos™ Mammalian Transfection Kit (Takara, 631312) following the manufacturer’s protocol into HEK293T cells ...
-
bioRxiv - Physiology 2021Quote: ... The PrimeScript RT reagent kit (Takara Bio, Otsu, Japan; cat. no. RR037A) was used to reverse transcribe total RNA (2 μg ...
-
bioRxiv - Bioengineering 2021Quote: ... Libraries were prepared using the Clontech SMARTer Stranded Total RNAseq Kit (Clontech), precleaned ...
-
bioRxiv - Genetics 2021Quote: ... AD-MSCs and iPSCs by using the Genomic DNA Extraction Kit (TaKaRa). PCR was performed by using Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized with the PrimeScript TMRT Master Mix kit (TaKaRa). qRT□PCR reactions were performed in triplicate using Mastercycler ep realplex (Eppendorf ...
-
bioRxiv - Plant Biology 2020Quote: ... and the resulting fragments were ligated using a DNA Ligation kit (Takara). The cDNAs of NPH3SA and NPH3SE within the pENTR vectors were transferred to both pH35GS and pH35YG binary vectors (Yamaguchi et al. ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized by using SMARTer PCR cDNA Synthesis Kit (Clontech, CA) according to the IsoSeq protocol (Pacific Biosciences ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcriptase was performed using the PrimeScript™ RT-PCR Kit (Takara). mRNA relative levels of SIGLEC1 were measured by two-step quantitative RT-PCR and normalized to GAPDH mRNA expression using the DDCt method ...
-
bioRxiv - Microbiology 2019Quote: ... RNAseq libraries were prepared with the SMARTer Stranded RNA-seq kit (TaKaRa) using 25ng of RNA input and 12 cycles for library amplification ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated following the protocol by the Trizol kit (TAKARA). SYBR Green (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... after purification and used a high-capacity cDNA reverse transcription kit (Takara) to reverse transcribe RNA into first-strand cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was then amplified with the SMARTer Ultra Low RNA kit (Clontech) including ERCC RNA spike-ins (ThermoFisher Scientific# 4456740) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara). Relative expression with respect to control (act2 gene ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... The sequencing libraries were prepared with ThruPLEX DNA-seq Kit (Takara Bio). The resulting libraries were characterized by using the Qubit dsDNA HS Assay Kit and BioAnalyzer 2100 High Sensitivity DNA Kit ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR product was purified using MiniBEST agarose gel DNA extraction kit (TaKaRa). Following DpnI digestion of the template at room temperature overnight ...
-
bioRxiv - Immunology 2022Quote: ... Lactate dehydrogenase activity was quantified using the LDH Cytotoxicity Detection Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed with the prime Script RT reagent kit (Takara). Differential regulation of cellular genes was assessed using TB Green™ Premix Ex Taq™ II (Tli RNase H Plus ...
-
bioRxiv - Biochemistry 2022Quote: ... Library was prepared using SMARTer smRNA-seq Kit for Illumina (Takara, 635029) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... by using PrimeScript™ RT reagent (Perfect Real Time) Kit (TaKaRa, Japan). All PCR amplifications were performed in triplicate ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by cDNA synthesis using SMARTer PCR cDNA synthesis Kit (Takara Bio).
-
bioRxiv - Cancer Biology 2022Quote: ... The ssDNA template was synthesized using GuideIt Long ssDNA kit (Takara #632666) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara).
-
bioRxiv - Neuroscience 2020Quote: ... according to the manufacturer’s protocol (AAV purification kit, reference 6666 from Takara and reference VPK-140 from Cell Biolabs) ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was isolated using an RNA Plus kit (Takara, Qingdao, China), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNA was amplified using a SYBR Green Master Mix Kit (Takara) in real-time PCR detection system.
-
bioRxiv - Plant Biology 2021Quote: ... reverse transcriptions were performed using PrimeScriptTM RT reagent kit (TaKaRa, Ohtsu, Japan). The RT-qPCR analyses were performed using the TransStart Tip Green qPCR SuperMix (TransGen ...