Labshake search
Citations for Takara Bio :
1301 - 1350 of 2457 citations for E 6 2 6 6 Trimethylcyclohex 2 en 1 yl hex 5 ene 2 4 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... Single colonies grown on selection plates were inoculated in 5 ml of SD-Leu-Trp overnight at 28 °C (ST0047, Takara Bio, USA). Saturated culture was then used to make serial dilutions of OD600 1 ...
-
bioRxiv - Microbiology 2020Quote: ... 30 sec polymerase activation at 98 °C followed by 30 cycles of 15 sec denaturing at 98 °C and 5 min annealing and extension at 65 °C (or variable values in gradient mode) in Thermal Cycler Dice ® (Takara Bio). The PCR products in Pool 1 and 2 reactions for same clinical samples were combined and purified with 1X concentration of AmpureXP.
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained on the dishes at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries from 5 ng total RNA were prepared using the SMARTer® Stranded Total RNA-Seq Kit (Takara Bio USA, #635005), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM DTT) supplemented with Pierce Protease Inhibitors EDTA-free (PIA32955) and Pierce Phosphatase Inhibitors (PIA32957) and RNase inhibitor (TaKaRa, cat# 2313A), and harvested by scraping ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% SDS and supplemented with Pierce Protease Inhibitors EDTA-free (PIA32955) and Pierce Phosphatase Inhibitors (PIA32957) and RNase inhibitor (TaKaRa, cat# 2313A) and 1 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.5 μl used as a source of genomic DNA in 20 μl PCRs with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). The amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA oligonucleotide adaptors were sequentially ligated to the 3’ and 5’ ends of small RNA by T4 RNA ligase (Takara, Dalian, China). cDNA synthesis was performed using oligo (dT ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (for immunohistochemistry 1:1000, Molecular Probes; for Western blotting: 1:10000, Clontech), mouse anti-Tubulin (1:80 ...
-
bioRxiv - Neuroscience 2020Quote: ... Single labeling involved exposure of sections to 1:25,000 or 1:100,000 anti-DSRed (Takara), 1:500 anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2022Quote: ... Immunofluorescent staining was performed using primary antibodies (FOS, #2250, Cell Signaling Technology, 1:1000; GFP, GFP1020, Aves Laboratories, 1:1000; dsRed, 632496, Takara, 1:1000), antibodies were reacted with species-specific Alexa Fluor-488 ...
-
bioRxiv - Microbiology 2020Quote: ... using each of the following 4 restriction enzymes: HaeIII or Hha I or Rsa I or Alu I (10 units, Takara Bio Co. Ltd. Shiga, Japan) in buffer solution (10xLow salt buffer ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... and an extra 15 bp at the 3’ and 5’ ends allowing their insertion into the linearized NheI-PacI pUASt-5C plasmid using In-Fusion cloning strategy (Takara Bio USA, Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Microbiology 2021Quote: ... the cDNAs were reverse-transcribed from 5 µg of total RNA with the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). Real time PCR (qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were collected into individual wells of 96 well-PCR plates containing 9.5 μL/well of freshly made lysis buffer (provided in SMART-Seq v4 Ultra Low Input kit for Sequencing (Takara Bio USA #634893)) ...
-
bioRxiv - Physiology 2022Quote: ... Kidney fibrosis was induced by one daily intraperitoneal injection of 0.2 μg/g body weight for 5 days of the chemical AP20187 (Takara Bio Inc. Kusatsu, Japan), in 8-10 weeks-old male transgenic mice ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Pathology 2020Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The primary antibody was incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were then blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) mixed with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The chosen primary antibody was then incubated overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Cancer Biology 2024Quote: ... Equal quantities (5 ng) of total RNA from each sample were used for cDNA synthesis using the PrimeScript®RT reagent kit (TaKaRa, Tokyo, Japan). The reverse transcriptions of miRNAs were performed using looped miRNA-specific RT primers for miRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture was subjected to three freeze-thaw cycles at -80 °C and 37 °C and treated with 5 units of DNase I (TaKaRa Bio, Otsu, Japan) and 20 ng RNase (Nippon Gene ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories, Inc. A Takara Bio Company, #639298) by heating to 98°C x 2 min followed by 20 cycles of 98°C x 10 s ...
-
bioRxiv - Immunology 2024Quote: ... 8 ul of cDNA 0.125 ng/μL was used as a starting material for library preparation using the the Unique Dual Index (UDI) kits (Takara bio, 634752-5) according to the vendor protocol ...
-
bioRxiv - Immunology 2024Quote: ... 2.5 ml of retroviral supernatant was transferred to a non-treated 24-well plate pre-coated with RetroNectin reagent (Takara cat# T100A/B) and centrifuged at 2000 g at 4°C for 2 hours to transduce T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: anti-GFP (chick 1:20) and anti-DsRed (rabbit, 1:50, Takara Bio#632496). Secondary antibodies ...
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on two plates (Takara Bio): (1 ...
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on three plates (Takara Bio): (1 ...