Labshake search
Citations for Takara Bio :
1301 - 1350 of 5176 citations for Cortisol ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Immunology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Physiology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Immunology 2021Quote: TCR cDNA libraries for high-throughput sequencing were prepared by 5’rapid amplification of cDNA ends (RACE) using the SMARTScribe™ Reverse Transcriptase (Clontech, USA) as previously described (39 ...
-
bioRxiv - Neuroscience 2021Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... Doxycycline-inducible NEK9 stable U2OS cell lines were generated through lentiviral transduction of parental U2OS cells stably carrying the pVLX-Tet-On-Advance vector (Clontech, PT3990-5). Briefly ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... We froze 5 μL of the supernatant in 45 μL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, Takara Bio Inc.) before analysis by polymerase chain reaction (PCR) ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).
-
bioRxiv - Microbiology 2020Quote: ... 30 sec polymerase activation at 98 °C followed by 30 cycles of 15 sec denaturing at 98 °C and 5 min annealing and extension at 65 °C (or variable values in gradient mode) in Thermal Cycler Dice ® (Takara Bio). The PCR products in Pool 1 and 2 reactions for same clinical samples were combined and purified with 1X concentration of AmpureXP.
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained on the dishes at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... 20 ng of sheared DNA was used for the library construction with ThruPLEX DNA Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA). Plasma and tumor DNA libraries were sequenced using paired-end 50 bp reads generated on the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Genomics 2020Quote: The cfDNA library construction was performed with the SMARTer ThruPLEX Plasma-Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA), as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was isolated using RNAqueous isolation kit (Thermo-Fisher, Waltham MA) and mRNA reverse transcribed using PrimeScript RT Reagent Kit (Takara Bio USA, Mountain View CA). Quantitative PCR reactions were carried out using PowerUp SYBR-Green master mix using StepOne Real-Time PCR systems (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were prepared for library prepraration using the SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian Kit for Sequencing (Takara Bio USA, Mountain View, CA). Total RNA was quantified and purity ratios determined for each sample using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Using the cDNA synthesis kit (TaKaRa: Moloney Murine Leukemia Virus Version), cDNA was synthesized from extracted RNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Transfection was carried out with CalPhosTM Mammalian Transfection Kit (Takara Bio) at a ratio of pLL3.7:psPAX2:MD2G = 20:15:6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then prepared using the PrimeScript RT reagent kit (TaKaRa). QPCR reactions were performed according to the manufacturer’s instructions using SYBR® Premix Ex Taq kit (TaKaRa) ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNAs were extracted using the RNAplus Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The amplicons were purified by DNA Amplification Clean Up Kit (Clontech). Amplicons were pooled in equimolar ratios prior to library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... the viral RNA was purified by NucleoSpin® RNA Kit (TAKARA). Recombinant INHis proteins (300 nM ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was extracted using NucleoSpin RNAII kit (Takara, Cat#740955.50). qRT-PCR was performed on 96-well optical reaction plates with one-step SYBR Green PCR master mix (Bio-Rad Laboratories ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the PrimeScript RT Reagent Kit with gDNA Eraser (TAKARA BIO). Real-time RT-PCR was performed using the THUNDERBIRD SYBR qPCT Mix (TOYOBO ...
-
bioRxiv - Evolutionary Biology 2020Quote: The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Takara) was used to generate first strand cDNA from 2.5 ng UNM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reverse transcription was performed using a PrimeScriptTM RT reagent kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sequencing libraries were constructed using ThruPLEX DNA-seq kit (Takara R400428). Sequencing was performed as described above ...
-
bioRxiv - Genomics 2022Quote: ... This was followed by a Reverse transcription reaction (SmartScribe kit Clontech) for 1 hour at 42°C and 70°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcriptase kit and PrimeSTAR Max DNA Polymerase were from TaKaRa. RiboLock RNase Inhibitor and RNase A (10 mg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were generated using the SMART-Seq Stranded Kit (Takara). This kit incorporates SMART® cDNA synthesis technology (28 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral titer was determined using the Lenti-X GoStix kit (Takara) following the manufacturer’s recommendations
-
bioRxiv - Genomics 2020Quote: ... we used the Cellartis® Hepatocyte Differentiation Kit (Takara Bio Inc.) and the Cellartis® DE Differentiation Kit (Takara Bio Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SMARTer Stranded Total RNA-Seq Kit - Pico Input (Clontech; 635005) and sequenced on the Illumina HiSeq 2500 sequencer (Illumina ...
-
bioRxiv - Immunology 2019Quote: ... Complementary DNA was obtained using Reverse Transcription Kit (Takara, Kyoto, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... and reverse-transcribed with a PrimeScript™ cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: PrimeScript RT Reagent Kit with gDNA Eraser – Perfect Real Time (Takara) was used according to manufacturer’s instructions ...