Labshake search
Citations for Takara Bio :
1251 - 1300 of 4961 citations for Rat Activity Dependent Neuroprotector Homeobox Protein ADNP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... The Mir-X miRNA First-Strand Synthesis Kit (TAKARA, Shiga, Japan) was used to convert RNAs into complementary DNA (cDNA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... We used the SmartScribe kit (Takara Bio USA, San Diego, CA) for RT-PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... the In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA) was used for cloning RiSKC3 into pFL61[GFP] plasmid ...
-
bioRxiv - Bioengineering 2019Quote: The OVCAR-8 and MCF-7 cell lines were stably transfected using expression vectors encoding the fluorescent protein DsRed2 from Clontech (Mountain View, CA) according to previously reported protocols (Brimacombe et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The open reading frame encoding each protein was amplified from RIB40 genomic DNA with PrimeSTAR® HS DNA Polymerase (TaKaRa Bio, Otsu, Japan) for high-fidelity PCR ...
-
bioRxiv - Microbiology 2023Quote: The open reading frames of 19 LD-associated proteins were amplified from RIB40 genomic DNA with PrimeSTAR® HS DNA Polymerase (TaKaRa, Otsu, Japan) for high-fidelity PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... and impact of SAID1/SAID2 on SE interaction with other proteins was examined on SD-His/-Leu/-Met/-Trp quadruple dropout medium (Clontech, Cat. No. 630429) supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT ...
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study and previously described: enhanced green fluorescent protein (EGFP) pEGFP-N1 (Clontech Laboratories, Mountain View, CA), pCI-neo HSV-2 UL21 (UL21 ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated from sort-purified NCR+ ILC3 and LTi-like ILC3 from SiLP using an RNA Purification Kit (Norgen) and amplified using SMART-Seq™ v4 Ultra Low Input RNA Kit for sequencing (Takara Bio USA, Inc., Mountain View, USA), producing double stranded cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1D libraries were prepared according to ONT protocol with 1D PCR Barcoding kit and full length non-directional sequencing was performed on PromethION instrument (using Clontech-SMART-Seq v4 Ultra Low Input kit). Basecalling was conducted using guppy version (v6.4.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the control wells of H441 cells were transfected with a plasmid DNA construct expressing enhanced green fluorescent protein (pHYG-EGFP; Clontech, Mountain View, CA, USA) and observed under Leica DM4000B fluorescent microscope.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Inducible expression of a Nef-eGFP fusion protein was established in CEM-T4 cells using the Lenti-XTM Tet-On System (Clontech now Takara Bio USA) which places expression of Nef-eGFP under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Neuroscience 2023Quote: ... sagittal sections (50 µm) of the cerebellum were cut and incubated with antibodies against the reporter protein mCherry (Clontech 632543, RRID: AB_2307319, 1:500) and against the P-cell marker calbindin (Swant CB38 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done using the PrimeScript™ RT reagent Kit (Takara) according to the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2020Quote: ... except ligation was performed using a BD In-FusionTM cloning kit (Clontech), according to the manufacturer’s instructions (primers listed in SI Appendix Table S12) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pCLT-mt1 and mt2 were generated by PrimeSTAR Mutagenesis Basal Kit (Takara). pET22b-TruB1 ...
-
bioRxiv - Cell Biology 2020Quote: Purified RNA was transcribed into cDNA using the PrimeScript Reagent Kit (Takara). The volume equivalent of 0.2 µg of RNA was reverse transcribed in a 40 µL reaction volume ...
-
bioRxiv - Genetics 2021Quote: ... and reverse transcription was performed using the PrimeScript RT Reagent Kit (Takara). Equal masses (concentration times volume ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared using SMARTer ThruPLEX DNA-Seq Kit (Takara Bio # R400675)
-
bioRxiv - Genetics 2021Quote: Using the SYBR Premix Ex TaqTM II kit (Takara Biotechnology, Tokyo, Japan) to perform the quantitative real-time PCR assay with CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2020Quote: ... was generated with the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.). The pCFD3-dU63gRNA plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... it was reverse transcribed using the PrimeScript™ RT reagent Kit (TaKaRa). The GPC segment was amplified and sequenced using primers ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragment was ligated using the In-Fusion cloning kit (Takara) into the pGL4.13[luc2/SV40] (E6681 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and RT-PCR was analyzed with gene specific primers listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: All constructs were obtained with the In-Fusion HD cloning kit (Takara) and sequence verified ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using a First Strand cDNA Synthesis Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 μL of 25 mM Dntp (Advantage UltraPure dNTP Combination Kit) (TaKaRa), 4.0 μL of 5× SSIV Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-qPCR was performed with a SYBR PrimeScript RT-qPCR Kit (Takara) for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... Viruses were titered using the Lenti-X p24 rapid titer kit (Takara). SH-SY5Y were transduced in 96-well plates at multiplicity of infection (MOI ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was generated with a PrimeScript RT Kit (Takara, Otsu, Shiga, Japan). Q-PCR was conducted to detect RNA amounts using FastStart Universal SYBR Green Master (ROX ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Immunology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Takara BioProduct) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Genomics 2020Quote: ... and RNA-seq libraries generated using the SMARTer cDNA synthesis kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... All PCR products were inserted using the In-Fusion cloning kit (Clontech) into the pBMDEL which had been linearized with BfuAI ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All cloning procedures were performed using the in-fusion cloning kit (Clontech).
-
bioRxiv - Genomics 2019Quote: ... Reverse transcription was performed with a PrimeScript RT-PCR Kit (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and PCR analyzed with primers chd-RT-F and chd-RT-R (Table 1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated using the In-Fusion® HD cloning kit (Takara Bio) according to manufacturer’s instructions or were purchased (Addgene) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription was performed with the PrimeScript RT reagent kit (RR037A, TaKaRa).
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Genomics 2020Quote: ... and reverse transcribed using PrimeScriptⅡ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The sequence of the LFY gene was amplified by PCR in 50-µL reaction mixture by using TaKaRa Ex Taq Hot Start Version (TaKaRa Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAseq library was prepared by DNA SMART ChIP Seq Kit (TAKARA #101617). RNA Sequencing was performed on Illumina NextSeq 500 desktop Next Generation Sequencing (NGS ...