Labshake search
Citations for Takara Bio :
1251 - 1300 of 6522 citations for Cow T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... LA Taq HS DNA polymerase kit from TaKaRa (TaKaRa Bio) conveyed the best performance and was therefore further used ...
-
bioRxiv - Genomics 2021Quote: ... using the In-Fusion® HD Cloning Kit (Takara/Clonetech). For transfection of reporter plasmids ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was accomplished with Reverse Transcription Kit (Takara, RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... A high-fidelity Advantage HF2 PCR kit (Takara, Cat#639123) was used in each of the PCR steps involved in preparing the sequencing libraries ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral titers were measured using AAVpro Titration Kit (#6233, Takara) or THUNDERBIRD SYBR qPCR Mix (QPS-201 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified using the Library quantification kit (Takara) and Thermal cycler Dice Realtime TP800 (Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... Following purification with Zymoclean Gel DNA Recovery Kit (ZD4008, Takara), product size distribution and quantity were assessed on a Bioanalyzer using an Agilent 2100 high-sensitivity DNA assay kit (5067-4626 ...
-
bioRxiv - Cell Biology 2022Quote: In-Fusion cloning (In-Fusion HD Cloning Plus Kit, Clontech) was used to fuse the fragments with the linearized backbone ...
-
bioRxiv - Genetics 2022Quote: ... The SMART-seq v4 Ultra Low input RNA kit (Clontech) was used to amplify cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesised using the PrimeScript II kit (Takara Bio). Total RNA and genomic DNA from A ...
-
bioRxiv - Microbiology 2022Quote: ... using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Real-time qPCR experiments were performed as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthesis of cDNA was performed using cDNA synthesis Kit (Takara). The qPCR was conducted on the Applied Biosystems instrument using the SYBR Green Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... or PrimeSTAR Mutagenesis Basal kit (Takara Bio Inc., Shiga, Japan): Y156V ...
-
bioRxiv - Plant Biology 2022Quote: ... using an In-Fusion HD cloning kit (Clontech Laboratories, USA). Targeting vectors were introduced into F1 sporelings of M ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Biochemistry 2024Quote: ... and RNA extraction kit were bought from Takara (Dalian, China). Ultrapure water was employed throughout the work ...
-
bioRxiv - Bioengineering 2024Quote: ... AAV was purified with the AAVpro Purification Kit (Takara, 6666) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... using In-Fusion® HD Cloning Kit (Takara Bio, #639650). Subsequently ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio). The quality ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was prepared using PrimeScript cDNA Synthesis Kit (DSS Takara Bio India Pvt ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SYBR RT-PCR Kit was purchased from Takara (Dalian, China). PHrodo-labelled E ...
-
bioRxiv - Developmental Biology 2024Quote: ... the SMART-seq v4 Ultra Low Input RNA kit (Takara) was used to prepare cDNAs starting from 1.5 µg of total RNA for each sample and sequencing libraries were prepared subsequently prepared using the Ovation Ultralow System V2 (NuGen) ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Physiology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Immunology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Cell Biology 2023Quote: ... using the In-Fusion ® HD Cloning Kit (Z9648N; TaKaRa).
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized by SMART-Seq mRNA kit (Takara, 634772). Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and pLL3.7m plasmids using CalPhos mammalian transfection kit (Takara Bio). Two days following transfection ...
-
bioRxiv - Systems Biology 2022Quote: ... viruses were purified using the Retro-X Concentrator kit (Clontech) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and pAAVDJ using the In-Fusion HD Cloning kit (Clontech) and QuikChange II Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using NucleoSpin Gel and PCR Clean-Up Kit (Takara), cloned into pRACE vector (provided in the kit ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa). qPCR was performed using the SYBR Green Master Mix (High ROX Premixed ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoBond HMW DNA kit (Takara) per the manufacturer’s instructions with a 50 °C proteinase K incubation for 4.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After transcribing using the In vitro Transcription T7 Kit (TaKaRa), BHK-21 cells were cotransfected with both full-length genomic and nucleoprotein gene RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the SYBR Premix Ex Taq kit (Takara, Shiga, Japan) was used as the reaction solution ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Bioengineering 2023Quote: ... The virus titer was determined using AAVPro titration kit (Takara).
-
bioRxiv - Genetics 2023Quote: ... RT was carried out with the PrimeScript Kit from TaKaRa. Quantitative RT-PCR reactions were carried out on a Real-time PCR machine (QuantStudio 5 by Applied Biosystems) ...
-
bioRxiv - Genetics 2023Quote: ... A Guide-it IVT RNA Clean-Up Kit (Takara Bio) was used to clean up the sgRNA solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection was done using the CalPhos mammalian transfection kit (Clontech). Alternatively ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). The plasmid was amplified using NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan); PrimeScript RT-PCR Kit (Takara Bio ...
-
bioRxiv - Bioengineering 2023Quote: ... Virus titers were determined using AAVpro Titration Kit Ver2 (TaKaRa).
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was extracted using a commercial kit (Takara, Japan) in line with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted using the NucleoSpin RNA Kit (Takara) following the manufacturer’s instructions ...