Labshake search
Citations for Takara Bio :
1201 - 1250 of 5147 citations for Mouse CXCL9 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 16 μm in thickness) were processed for immunodetection of Mouse anti-GFP antibody (1:500, 632381, Takara Bio USA, Inc. Mountain View, CA) and incubated with secondary Donkey anti-Mouse Alexa Fluor 488 (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were directed against IBA1 (rabbit-anti-iba1 WAKO chemicals 019-19741 1:1000) and tdTomato (mouse-anti-dsRed Takara 632392 1:1000). Secondary antibodies were goat anti-rabbit or anti-mouse conjugated with Alexa dyes 488 and 568 (1:1000) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Gastruloids were prepared by aggregating 300 mouse embryonic stem cells in 40 μl droplets of N2B27 (NDiff® 227, Takara Bio Inc. Y40002) per well of U-bottomed 96-well plates (Greiner 650185 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-nc82 (mouse, 1:10; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) and anti-DsRed (rabbit, 1:500; Takara Bio, Kyoto, JP). Brains were washed three times again in PBS with 0.2% Triton X-100 and transferred into secondary antibody solution (anti-chicken Alexa Fluor 488 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Neuroscience 2023Quote: ... the brain slices were first blocked in 10% goat serum made in 0.1% Triton X-100/1× PBS and then incubated in anti-GFP antibodies (1/1000, RT, overnight, Mouse anti-GFP, 632381, Takara Bio USA, WI) followed by Alexa-488 secondary antibodies (1/200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done using the PrimeScript™ RT reagent Kit (Takara) according to the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2020Quote: ... except ligation was performed using a BD In-FusionTM cloning kit (Clontech), according to the manufacturer’s instructions (primers listed in SI Appendix Table S12) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pCLT-mt1 and mt2 were generated by PrimeSTAR Mutagenesis Basal Kit (Takara). pET22b-TruB1 ...
-
bioRxiv - Cell Biology 2020Quote: Purified RNA was transcribed into cDNA using the PrimeScript Reagent Kit (Takara). The volume equivalent of 0.2 µg of RNA was reverse transcribed in a 40 µL reaction volume ...
-
bioRxiv - Genetics 2021Quote: ... and reverse transcription was performed using the PrimeScript RT Reagent Kit (Takara). Equal masses (concentration times volume ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared using SMARTer ThruPLEX DNA-Seq Kit (Takara Bio # R400675)
-
bioRxiv - Genetics 2021Quote: Using the SYBR Premix Ex TaqTM II kit (Takara Biotechnology, Tokyo, Japan) to perform the quantitative real-time PCR assay with CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2020Quote: ... was generated with the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.). The pCFD3-dU63gRNA plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... it was reverse transcribed using the PrimeScript™ RT reagent Kit (TaKaRa). The GPC segment was amplified and sequenced using primers ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragment was ligated using the In-Fusion cloning kit (Takara) into the pGL4.13[luc2/SV40] (E6681 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and RT-PCR was analyzed with gene specific primers listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: All constructs were obtained with the In-Fusion HD cloning kit (Takara) and sequence verified ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using a First Strand cDNA Synthesis Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 μL of 25 mM Dntp (Advantage UltraPure dNTP Combination Kit) (TaKaRa), 4.0 μL of 5× SSIV Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-qPCR was performed with a SYBR PrimeScript RT-qPCR Kit (Takara) for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... Viruses were titered using the Lenti-X p24 rapid titer kit (Takara). SH-SY5Y were transduced in 96-well plates at multiplicity of infection (MOI ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was generated with a PrimeScript RT Kit (Takara, Otsu, Shiga, Japan). Q-PCR was conducted to detect RNA amounts using FastStart Universal SYBR Green Master (ROX ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Immunology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Takara BioProduct) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Genomics 2020Quote: ... and RNA-seq libraries generated using the SMARTer cDNA synthesis kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... All PCR products were inserted using the In-Fusion cloning kit (Clontech) into the pBMDEL which had been linearized with BfuAI ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All cloning procedures were performed using the in-fusion cloning kit (Clontech).
-
bioRxiv - Genomics 2019Quote: ... Reverse transcription was performed with a PrimeScript RT-PCR Kit (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and PCR analyzed with primers chd-RT-F and chd-RT-R (Table 1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated using the In-Fusion® HD cloning kit (Takara Bio) according to manufacturer’s instructions or were purchased (Addgene) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription was performed with the PrimeScript RT reagent kit (RR037A, TaKaRa).
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Genomics 2020Quote: ... and reverse transcribed using PrimeScriptⅡ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The sequence of the LFY gene was amplified by PCR in 50-µL reaction mixture by using TaKaRa Ex Taq Hot Start Version (TaKaRa Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAseq library was prepared by DNA SMART ChIP Seq Kit (TAKARA #101617). RNA Sequencing was performed on Illumina NextSeq 500 desktop Next Generation Sequencing (NGS ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified sequences were inserted using InFusion (InFusion HD Cloning kit, Clontech). Plasmid constructs were injected into one-cell zygotes and integrated into the genome via Ac-mediated recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... The transgene plasmid was generated using the InFusion HD Kit (Clontech, 638910) and the NucleoBond Xtra Midi EF Kit (Macherey-Nagel ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA sequencing libraries were prepared using a SmartSeq HT kit (Takara Bio) and Illumina Nextera XT kit (Illumina Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and inserted into the pFastBac vector using In-Fusion kit (TaKaRa # 638910). Inserts encoding wild-type or mutant Myo1e fragments (motor domain + IQ motif ...
-
bioRxiv - Genomics 2021Quote: ... by calcium phosphate transfection with CalPhos™ Mammalian Transfection Kit (Takara, 631312) following the manufacturer’s protocol into HEK293T cells ...
-
bioRxiv - Physiology 2021Quote: ... The PrimeScript RT reagent kit (Takara Bio, Otsu, Japan; cat. no. RR037A) was used to reverse transcribe total RNA (2 μg ...
-
bioRxiv - Bioengineering 2021Quote: ... Libraries were prepared using the Clontech SMARTer Stranded Total RNAseq Kit (Clontech), precleaned ...