Labshake search
Citations for Takara Bio :
1201 - 1250 of 2709 citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech, Mountain View, C.A.) as described (44) ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Microbiology 2023Quote: ... or the BamHI/MluI site of pWPI-ACE2-zeo (for ACE2 expression plasmids)43 with 3×FLAG-tag at the C-terminus using In-Fusion® HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml; Clontech, Palo Alto, CA, USA) to select resistant clones.
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Media containing lentiviral particles was collected 72 hours post-transfection and the lentiviral particles were precipitated with 3 volumes of Lenti-X Concentrator (Takara, cat. no. 631232) at 4°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... the genomic sequence from the MpRKD promoter region (3827 bp upstream from start codon) to the 3’UTR was amplified by PCR with PrimeSTAR HS DNA polymerase (TaKaRa Bio, Kusatsu, Japan) and the primers IF-Hind-pRKD-F and IF-Sal-gRKD-R ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from 4-week-old seedlings of Chinese wildrye treated with 100 mM Na2CO3 using RNAiso plus (TaKaRa, Japan) according to the instruction manual ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR product was gel-purified and 400 ng of the purified product were used in a random priming reaction containing: 4 Units Klenow fragment (TAKARA, Japan), 5 μl 10x Klenow reaction buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Immunology 2021Quote: ... First strand cDNA synthesis was performed with 4 μg of total RNA per reaction using PrimeScript™ II 1st Strand cDNA Synthesis Kit and oligo-dT primer (TAKARA) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA libraries were synthesized with 4 ng of total RNA input to the Clontech SMARTer smRNA-seq kit (Takara Bio 635034) using the manufacturer’s suggested protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... We then aspirated the cell with as little buffer as possible and blew it into 4μl lysis buffer [4 units of Recombinant RNase Inhibitor (Takara, Cat.No.2313), 2.5μM poly(T)30VN primer (Sangon) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Co-IPs were carried out by incubating the samples with 30 μL of protein A agarose bead slurry for 4h at 4°C in a rotating wheel and with anti-mCherry (Takara 632496) of 1:1000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... StNPR1 or StNPR3/4 cds) construct combinations were transformed into the Y2H Gold strain using the Matchmaker Gold Yeast Two-Hybrid System (Clontech, USA) and the transformants selected on control SD media without Leu and Trp (-L-W) ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were centrifuged at 16,000 RCF for 5 min at 4°C and the supernatant was reserved for DNA clean-up using NucleoSpin® Gel and PCR Clean-Up (740609, Takara) based on manufacture instructions or ethanol precipitation.
-
bioRxiv - Plant Biology 2024Quote: ... Samples were then run on a 4-12% Bis-Tris gel and transferred to a membrane for western blotting using α-GFP (Clontech) and α-HA (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...