Labshake search
Citations for Takara Bio :
1151 - 1200 of 5042 citations for Pyruvate Dehydrogenase Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared using SMARTer ThruPLEX DNA-Seq Kit (Takara Bio # R400675)
-
bioRxiv - Genetics 2021Quote: Using the SYBR Premix Ex TaqTM II kit (Takara Biotechnology, Tokyo, Japan) to perform the quantitative real-time PCR assay with CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2020Quote: ... was generated with the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.). The pCFD3-dU63gRNA plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... it was reverse transcribed using the PrimeScript™ RT reagent Kit (TaKaRa). The GPC segment was amplified and sequenced using primers ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragment was ligated using the In-Fusion cloning kit (Takara) into the pGL4.13[luc2/SV40] (E6681 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and RT-PCR was analyzed with gene specific primers listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: All constructs were obtained with the In-Fusion HD cloning kit (Takara) and sequence verified ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using a First Strand cDNA Synthesis Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 μL of 25 mM Dntp (Advantage UltraPure dNTP Combination Kit) (TaKaRa), 4.0 μL of 5× SSIV Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-qPCR was performed with a SYBR PrimeScript RT-qPCR Kit (Takara) for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... Viruses were titered using the Lenti-X p24 rapid titer kit (Takara). SH-SY5Y were transduced in 96-well plates at multiplicity of infection (MOI ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was generated with a PrimeScript RT Kit (Takara, Otsu, Shiga, Japan). Q-PCR was conducted to detect RNA amounts using FastStart Universal SYBR Green Master (ROX ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Immunology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Takara BioProduct) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Genomics 2020Quote: ... and RNA-seq libraries generated using the SMARTer cDNA synthesis kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... All PCR products were inserted using the In-Fusion cloning kit (Clontech) into the pBMDEL which had been linearized with BfuAI ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All cloning procedures were performed using the in-fusion cloning kit (Clontech).
-
bioRxiv - Genomics 2019Quote: ... Reverse transcription was performed with a PrimeScript RT-PCR Kit (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and PCR analyzed with primers chd-RT-F and chd-RT-R (Table 1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated using the In-Fusion® HD cloning kit (Takara Bio) according to manufacturer’s instructions or were purchased (Addgene) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription was performed with the PrimeScript RT reagent kit (RR037A, TaKaRa).
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Genomics 2020Quote: ... and reverse transcribed using PrimeScriptⅡ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The sequence of the LFY gene was amplified by PCR in 50-µL reaction mixture by using TaKaRa Ex Taq Hot Start Version (TaKaRa Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAseq library was prepared by DNA SMART ChIP Seq Kit (TAKARA #101617). RNA Sequencing was performed on Illumina NextSeq 500 desktop Next Generation Sequencing (NGS ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified sequences were inserted using InFusion (InFusion HD Cloning kit, Clontech). Plasmid constructs were injected into one-cell zygotes and integrated into the genome via Ac-mediated recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... The transgene plasmid was generated using the InFusion HD Kit (Clontech, 638910) and the NucleoBond Xtra Midi EF Kit (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA sequencing libraries were prepared using a SmartSeq HT kit (Takara Bio) and Illumina Nextera XT kit (Illumina Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and inserted into the pFastBac vector using In-Fusion kit (TaKaRa # 638910). Inserts encoding wild-type or mutant Myo1e fragments (motor domain + IQ motif ...
-
bioRxiv - Genomics 2021Quote: ... by calcium phosphate transfection with CalPhos™ Mammalian Transfection Kit (Takara, 631312) following the manufacturer’s protocol into HEK293T cells ...
-
bioRxiv - Physiology 2021Quote: ... The PrimeScript RT reagent kit (Takara Bio, Otsu, Japan; cat. no. RR037A) was used to reverse transcribe total RNA (2 μg ...
-
bioRxiv - Bioengineering 2021Quote: ... Libraries were prepared using the Clontech SMARTer Stranded Total RNAseq Kit (Clontech), precleaned ...
-
bioRxiv - Genetics 2021Quote: ... AD-MSCs and iPSCs by using the Genomic DNA Extraction Kit (TaKaRa). PCR was performed by using Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized with the PrimeScript TMRT Master Mix kit (TaKaRa). qRT□PCR reactions were performed in triplicate using Mastercycler ep realplex (Eppendorf ...
-
bioRxiv - Plant Biology 2020Quote: ... and the resulting fragments were ligated using a DNA Ligation kit (Takara). The cDNAs of NPH3SA and NPH3SE within the pENTR vectors were transferred to both pH35GS and pH35YG binary vectors (Yamaguchi et al. ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized by using SMARTer PCR cDNA Synthesis Kit (Clontech, CA) according to the IsoSeq protocol (Pacific Biosciences ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcriptase was performed using the PrimeScript™ RT-PCR Kit (Takara). mRNA relative levels of SIGLEC1 were measured by two-step quantitative RT-PCR and normalized to GAPDH mRNA expression using the DDCt method ...
-
bioRxiv - Microbiology 2019Quote: ... RNAseq libraries were prepared with the SMARTer Stranded RNA-seq kit (TaKaRa) using 25ng of RNA input and 12 cycles for library amplification ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated following the protocol by the Trizol kit (TAKARA). SYBR Green (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... after purification and used a high-capacity cDNA reverse transcription kit (Takara) to reverse transcribe RNA into first-strand cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was then amplified with the SMARTer Ultra Low RNA kit (Clontech) including ERCC RNA spike-ins (ThermoFisher Scientific# 4456740) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara). Relative expression with respect to control (act2 gene ...