Labshake search
Citations for Takara Bio :
1151 - 1200 of 1390 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2.6 x 106 yeast transformants were screened on 2% SD/Gal/Raf/X-P-gal (-Ura/-His/-Trp/-Leu) following the manufacturer’s instructions (Clontech). Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech) ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100 [Nacalai Tesque], 0.7 μL of 2% bovine serum albumin [BSA] [Takara Bio]) and incubation at 70°C for 90 sec to quench the denaturing effect of SDc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Microbiology 2024Quote: ... The protein-bead mixtures were then loaded onto a gravity column (TALON 2 mL Disposable Gravity Column, Takara #635606). Lysate was loaded into the column 5 times with gravity flow and then washed in a 1M NaCl buffer 3 times ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... CHO-K1 cells were transiently co-transfected with 2 µg KV4.3 (cloned into pBK- CMV vector, amplified by PCR and ligated into pmCherry-C1 (Clontech), by using XhoI and HindIII restriction sites,23 and 1 µg KChIP2 (cloned into IRES mCherry KChIP2 using XbaI and XhoI restriction sites).
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by incubation at 37°C for 1 hour with 2 µl of Klenow Fragment (Takara Bio Inc, Japan) and inactivation at 65°C for 5 minutes ...
-
bioRxiv - Systems Biology 2020Quote: ... full length double stranded cDNA (dscDNA) was generated using the SMART-Seq version 4 Ultra Low Input kit (Takara Bio USA, Mountain View, CA) and the Nextera XT DNA Library Preparation kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... NK cells were transduced on day 4 of culture using transiently produced replication incompetent RD114 pseudotyped retroviral particles immobilized on RetroNectin (Clontech Laborotories, Palo Alto, CA).
-
bioRxiv - Molecular Biology 2022Quote: ... Section B step 4 in the protocol was modified to account for the incorporation of UDIs (Takara SMARTer RNA Unique Dual Index Kit-96A). A total of 2 uL of each UDI was used instead of the recommended 1 uL each of the 5’ and 3’ PCR primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were blocked as above and then incubated overnight at 4 °C with appropriate antibodies to GFP (1:1000 dilution; Clontech, Catalog No. 1. 632381) and tubulin α (1:2000 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Evolutionary Biology 2023Quote: SARS-CoV-2 cDNA was generated from 100 ng of RNA in a RT-PCR reaction buffer containing 4 μL of 5X PrimeScript IV 1st strand cDNA Synthesis Mix (Takara Bio, Kusatsu, Shiga, Japan), 2 μL of 50 μM random hexamer primer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pdum-Lox2 and Avi-Post2 the SMART™ (Switching Mechanism At 5’ end of the RNA Transcript) RACE method (SMART™ RACE cDNA amplification kit, Clontech) was used (Brena et al. ...
-
bioRxiv - Immunology 2021Quote: TCR cDNA libraries for high-throughput sequencing were prepared by 5’rapid amplification of cDNA ends (RACE) using the SMARTScribe™ Reverse Transcriptase (Clontech, USA) as previously described (39 ...
-
bioRxiv - Neuroscience 2021Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... Single colonies grown on selection plates were inoculated in 5 ml of SD-Leu-Trp overnight at 28 °C (ST0047, Takara Bio, USA). Saturated culture was then used to make serial dilutions of OD600 1 ...
-
bioRxiv - Microbiology 2020Quote: ... 30 sec polymerase activation at 98 °C followed by 30 cycles of 15 sec denaturing at 98 °C and 5 min annealing and extension at 65 °C (or variable values in gradient mode) in Thermal Cycler Dice ® (Takara Bio). The PCR products in Pool 1 and 2 reactions for same clinical samples were combined and purified with 1X concentration of AmpureXP.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained on the dishes at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...