Labshake search
Citations for Takara Bio :
1101 - 1150 of 5307 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... with In-Fusion® HD Cloning Kit (Takara Bio, Inc.) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... According to the BD Genome Walker Universal Kit (Clontech, USA) manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... TAKARA Bio SMART-Seq Stranded Kit User Manual (TAKARA Bio) was used with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... pseudotuberculosis were performed using an In-fusionHD cloning kit (Clontech) according to the manufacturer’s instructions ...
-
The evolution of red colour vision is linked to coordinated rhodopsin tuning in lycaenid butterfliesbioRxiv - Evolutionary Biology 2020Quote: ... We thereafter used the SMARTer RACE cDNA Amplification kit (Clontech) to prepare 5’- and 3’- RACE cDNA for each species ...
-
bioRxiv - Genetics 2021Quote: ... by using the In-Fusion HD Cloning Kit (Takara Bio).
-
bioRxiv - Plant Biology 2021Quote: ... and reverse transcribed RNA to cDNA by TransScript Kit (TaKaRa). The expression of CYP86A4 was detected by RT-PCR or quantitative RT-PCR using forward primer 5’-CCCCAAGGGTTTCACTGAATTC-3’ and reverse primer 5’-AAGTAAATGCGAAGCCTGCTTG −3’ and Applied Biosystem Step One real-time PCR system or TaKaRa SYBR Premix Ex Taq II reagent kit ...
-
bioRxiv - Physiology 2020Quote: ... and SYBR ® Premix Ex Taq™ II kit (Takara) were used for qRT-PCR target fragment ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated by RT Master reverse transcription kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the In-Fusion HD EcoDry cloning kit (Takara Bio), resulting in the plasmid pDriveΔsrtA ...
-
bioRxiv - Microbiology 2020Quote: ... First strand cDNA was synthesized using PrimeScript RT kit (TakaRa). Optimized ddPCR was used to detect the presence of SARS-CoV-2 viruses following our previous study.10 Analysis of the ddPCR data was performed with QuantaSoft software (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... The SMART-Seq Single Cell Kit (SSsc; Cat. # 634472, Takara) was used and reaction volumes were miniaturized 6 times with the aid of the Mosquito HV robot as per the kit provider User Guide (cDNA synthesis using the mosquito HV genomics with the SMART-Seq® Single Cell Kit ...
-
bioRxiv - Biochemistry 2021Quote: ... In-Fusion HD cloning kit (638909) was purchased from Takara. All enzymes and buffers used in cloning were purchased from New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected using the CalPhos Mammalian Transfection Kit (Clontech) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized using the PrimeScript RT reagent kit (Takara). Real-time quantitative PCR was performed in triplicate using the SYBR Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2021Quote: All Lenti-X products and kits were purchased from Takara Bio USA Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... In-Fusion cloning (In-Fusion HD Cloning Plus kit, Clontech) was used to fuse the sh1-resistant MFN2 fragment with the linearized backbone ...
-
bioRxiv - Genomics 2021Quote: The cDNAs were synthesized using SMARTScribe Reverse Transcription Kit (TaKaRa). Two pairs of primers that target either both exons b and c or exon b only were used to amplify these two exons ...
-
bioRxiv - Molecular Biology 2021Quote: ... pRev and pVSVG using CalPhos mammalian transfection kit (TaKaRa Clontech). Next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... pRev and pVSVG using CalPhos mammalian transfection kit (TaKaRa Clontech). Next day ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was isolated using MN Nucleospin RNA kit (Takara). Equal quantities of RNA were reverse transcribed using Primescript Reverse transcriptase and random hexamers (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara). Quantification of transcripts was performed on a Mx3005P QPCR system (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... LA Taq HS DNA polymerase kit from TaKaRa (TaKaRa Bio) conveyed the best performance and was therefore further used ...
-
bioRxiv - Genomics 2021Quote: ... using the In-Fusion® HD Cloning Kit (Takara/Clonetech). For transfection of reporter plasmids ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was accomplished with Reverse Transcription Kit (Takara, RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and pLL3.7m plasmids using CalPhos mammalian transfection kit (Takara Bio). Two days following transfection ...
-
bioRxiv - Systems Biology 2022Quote: ... viruses were purified using the Retro-X Concentrator kit (Clontech) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and pAAVDJ using the In-Fusion HD Cloning kit (Clontech) and QuikChange II Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using NucleoSpin Gel and PCR Clean-Up Kit (Takara), cloned into pRACE vector (provided in the kit ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa). qPCR was performed using the SYBR Green Master Mix (High ROX Premixed ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoBond HMW DNA kit (Takara) per the manufacturer’s instructions with a 50 °C proteinase K incubation for 4.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After transcribing using the In vitro Transcription T7 Kit (TaKaRa), BHK-21 cells were cotransfected with both full-length genomic and nucleoprotein gene RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the SYBR Premix Ex Taq kit (Takara, Shiga, Japan) was used as the reaction solution ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Bioengineering 2023Quote: ... The virus titer was determined using AAVPro titration kit (Takara).
-
bioRxiv - Genetics 2023Quote: ... RT was carried out with the PrimeScript Kit from TaKaRa. Quantitative RT-PCR reactions were carried out on a Real-time PCR machine (QuantStudio 5 by Applied Biosystems) ...
-
bioRxiv - Genetics 2023Quote: ... A Guide-it IVT RNA Clean-Up Kit (Takara Bio) was used to clean up the sgRNA solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection was done using the CalPhos mammalian transfection kit (Clontech). Alternatively ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). The plasmid was amplified using NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan); PrimeScript RT-PCR Kit (Takara Bio ...
-
bioRxiv - Bioengineering 2023Quote: ... Virus titers were determined using AAVpro Titration Kit Ver2 (TaKaRa).
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Biochemistry 2024Quote: ... and RNA extraction kit were bought from Takara (Dalian, China). Ultrapure water was employed throughout the work ...
-
bioRxiv - Bioengineering 2024Quote: ... AAV was purified with the AAVpro Purification Kit (Takara, 6666) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... using In-Fusion® HD Cloning Kit (Takara Bio, #639650). Subsequently ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio). The quality ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was prepared using PrimeScript cDNA Synthesis Kit (DSS Takara Bio India Pvt ...