Labshake search
Citations for Takara Bio :
1101 - 1150 of 1414 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... pDUP50M1 or pDUP51-ΔM and pDUP50-ΔM (a kind gift from D. L. Black, UCLA, USA) and pCMS-EGFP (Takara Bio USA, Inc) or pEGFP-IQGAP1 (Ren et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... total RNA was isolated by standard procedure from 20-30 heads of homozygous Aprt5 flies and reverse transcribed using oligo d(T) primers (PrimeScript RT Reagent Kit, Takara Bio, Kyoto, Japan). At least 750 ng of the first strand cDNA was amplified by PCR in 20 μl of reaction mixture using PrimeStar Max DNA polymerase (Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were single-cell sorted into 96-well low-bind PCR-plates [Eppendorf] containing 3 μl of lysis buffer (0.5 units/μl RNase inhibitor [Takara] ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Biochemistry 2020Quote: ... The final supernatant was supplemented with NaCl to 150 mM and incubated with 3 mL His60 resin (Takara Biosciences) for 30 min ...
-
bioRxiv - Cancer Biology 2020Quote: Libraries were prepared using 1ng of purified cDNA according to the ICELL8® 3’ DE instruction manual (Takara Bio) using the Nextera Primer P5 (ICELL8® 3’ DE Kit ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Bioengineering 2022Quote: About 130 ml of clarified cell suspension was combined with 3 mL of TALON® resin (Takara Bio 635503) previously equilibrated in lysis buffer and rocked at 4°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: The s2m sequence or control scrambled sequence of s2m (s2m_scr) was inserted into the 3’ UTR of GFP in H6P plasmid using In-Fusion Cloning kit (TaKaRa) and verified by sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant with the soluble His6-UppH was loaded on to a 3 ml TALON Metal Affinity Resin (Clontech) equilibrated in binding buffer (50 mM Na2HPO4 ...
-
bioRxiv - Microbiology 2022Quote: ... and the 3’ flanking region) and the linearized pHIS906 were fused using the In-Fusion enzyme (TAKARA, Shiga, Japan) to create the pHIS3-AWP1 plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... then imaged after overnight expression and ∼3 hour incubation with 500 nM A/C heterodimerizer linker drug (Takara, 635055) or 100% ethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant adenovirus vaccines were produced using the Adeno-X™ Adenoviral System 3 according to the manufacturer’s manual (Takara Korea Biomedical Inc. ...
-
bioRxiv - Biophysics 2024Quote: ... to reduce the detergent concentration and incubated for 3 h with 10 mL Talon metal affinity resin (Takara Biotech) pre-equilibrated with buffer S supplemented with 0.1% β-DDM and 0.02% CHS ...
-
bioRxiv - Immunology 2024Quote: ... sfGFP-3×P3-DsRed and homology arms were PCR-amplified using PrimeSTAR® Max DNA Polymerase (Takara Bio, R045). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HRT for attaching GFP at the 3’ end of pan-1 was made by PCR (Takara PrimeStar Max) from plasmid pPD95.75 (Addene #1494 ...
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Genomics 2020Quote: ... 5 × 104 cells were stored at −80 °C in STEM CELLBANKER® (Takara Bio Inc.) until use ...
-
bioRxiv - Plant Biology 2020Quote: The 5’ Digoxigenin labeled R-box and non-labeled oligonucleotides were synthesized (Takara, Dalian, China). The binding mixture contained nuclear extracts ...
-
bioRxiv - Biophysics 2022Quote: ... This was then loaded onto a column with 5 ml His60 Ni-Superflow Resin (Clontech) previously equilibrated in the lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were probed with γ32P 5’ end-labeled oligonucleotide (Table S3) in ExpressHyb solution (Clontech) and scanned after exposition with Typhoon FLA 9500 scanner (GE Healthcare).
-
bioRxiv - Molecular Biology 2020Quote: ... They were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Cla I sites 5′ to the BamH I site (Clontech, Mountain View, CA, USA).
-
bioRxiv - Immunology 2024Quote: ... QPCR was then performed with a reaction mixture consisting of 5 μL SYBR Green (Takara), 0.2 μL Rox ...
-
bioRxiv - Microbiology 2023Quote: ... Synthesized DNA was cloned into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was prelinearized with NotI-HF (New England Biolabs [NEB] ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and CCR6high and transduced with lentivirus particles at an MOI of 5 using retronectin (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Neuroscience 2020Quote: ... cerevisiae strains used for yeast two-hybrid analysis were Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech) and Y2H Gold (MATa ...
-
bioRxiv - Genomics 2021Quote: ... These nanowells were selected for subsequent targeted deposition of 50□nl/nanowell RT-PCR reaction mix from the SMARTer ICELL8 3’ DE Reagent Kit (Takara) using the MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-GGC ATG GAC GAG CTG TAC AAG TCC AAT TTA CTG ACC GTA CAC-3’ and on pEGFP-C1 (Clontech) with primer ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).
-
bioRxiv - Microbiology 2022Quote: ... A second construct for total gene deletion was generated by cloning the 5’ (843 bp) and 3’ (292 bp) homology regions amplified by PCR using a Taq DNA polymerase with proofreading activity (Takara) and primers P9 + P12 and P13 + P14 into the pL0001 vector (BEI Resources ...
-
bioRxiv - Microbiology 2022Quote: ... and McGee_sabB_rev (5’ atcgataagcgaattcttaataagcaaacacataattgagatacacgctataaagc 3’) and cloned into the pDYC40 plasmid that contains a kanamycin resistance cassette 55 via In-Fusion cloning (Takara). This plasmid is designed for complementation at a previously characterized ...
-
bioRxiv - Genomics 2022Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (Zhu et al. ...