Labshake search
Citations for Takara Bio :
1101 - 1150 of 2207 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... to 7.5μL eluted RNA 2.5μL smRNA mix 1 (Takara Cat. #635031) and 1μL 10uM UMI RT primer (seq ...
-
bioRxiv - Genetics 2024Quote: ... and 1 U TaKaRa LA Taq (Takara Bio Inc., Kyoto, Japan) was prepared ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP (Living Colors, Takara Biotech, San Jose CA, 632375; 1:2000), Pfn1 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... the primary antibodies (anti-DsRed in rabbit 1:1000 (632496, Takara); anti-GFP in chicken 1:1000 (13970 ...
-
bioRxiv - Plant Biology 2024Quote: ... following in the Yeast User Manual PT4087-1 (Clontech, Shiga, Japan). The CDSs of the corresponding TFs NbMYB42 and NbARF18La/b were cloned into the pGADT7 vector ...
-
bioRxiv - Genomics 2024Quote: ... TALON® Metal Affinity Resin (1 mL) (Takara Biosciences, catalog # 635504) was equilibrated with Lysis Buffer ...
-
bioRxiv - Immunology 2024Quote: ... was synthesized by GenScript (Piscataway NJ) and subcloned in a pLVX-IRES-zsGreen 1 (Takara Bio ...
-
bioRxiv - Genetics 2024Quote: ... and 1 μL of T4 Polynucleotide Kinase (10 U/μL; TAKARA) were added ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: Cas9 (Takara, 632607; 1:150), MAP2 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal GFP (JL-8, 632381, 1:2000 for immunoblotting, Clontech); Alexa Fluor-488- ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... SMARTScribe reverse transcriptase (5 U/uL, Takara), Template-Switching Oligo (TSO ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ and 3’-ends of RBK21 cDNA were analyzed using 5’-Full and 3’-Full RACE core sets (TAKARA) with specific primers (Extended Data Table 8) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... the enhanced yellow fluorescent protein (YFP) from pEYFP-N1 (#6006-1, Clontech), the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE ...
-
bioRxiv - Neuroscience 2021Quote: ... the primary antibody rabbit anti-dsRed (Takara Bio, Cat# 632496, 1:500) and the secondary antibody goat anti-rabbit ...
-
bioRxiv - Cell Biology 2021Quote: Purified proteins or polymers were diluted using 1× PBS (Takara Bio, T900), and loaded into custom-made microneedles prepared with the P1000IVF micropipette puller (Sutter Instrument) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA from 1×106 K562 cells were extracted using Trizol (Takara) and purified with Qiagen RNAeasy mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... then primary staining for mCherry (rabbit anti-DsRed, 632393, Clontech, 1:300) and secondary staining (goat anti-rabbit Ig Cy3 ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... and a pAb anti-GFP (632592, WB: 1/1000) was from Takara. All secondary Abs for immunofluorescence (IF ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:1,000 for rabbit anti-DsRed (Takara Bio USA #632496, RRID: AB_10013483)) were applied to the samples at 4°C for 2 days ...
-
bioRxiv - Cancer Biology 2021Quote: ... relative cell mass was assessed using WST-1 Cell Proliferation Reagent (Clontech) per manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DSRed antibody (Living Colours; Clontech; Cat# 632496, dilution 1:300), rabbit anti-red fluorescent protein (RFP ...
-
bioRxiv - Neuroscience 2021Quote: ... and/or anti-DsRed (host: rabbit, 1/500, #632496 Takara Bio Clontech). Slices were then rinsed three times in PBS (10 min each ...
-
bioRxiv - Neuroscience 2021Quote: ... and/or anti-DsRed (host: rabbit, 1/500, #632496 Takara Bio Clontech). Slices were then rinsed three times in PBS (10 min each ...
-
bioRxiv - Microbiology 2020Quote: M.tb H37Ra were pelleted and re-suspended in 1 mLTrizol Reagent (TAKARA), and then homogenized using Lysing Matrix B (MP Bio Medical ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression of CLPTM1L-mEGFP was induced by 1 µg/mL doxycycline (TaKaRa) and maintained in DMEM supplemented with Tet System Approved FBS (631107 ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated with Rabbit anti-ZsGreen (Clontech, Cat. No. 632474, 1:10,000) for 15-18hrs at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with mouse anti-GFP (1:500, Takara Bio, 632380), rabbit anti-mCherry (1:500 ...