Labshake search
Citations for Takara Bio :
1051 - 1100 of 3141 citations for Probable U3 small nucleolar RNA associated protein 11 UTP11 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted using the RNAiso Plus (Takara Bio, Shiga, Japan). cDNA synthesis was performed using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo ...
-
bioRxiv - Immunology 2021Quote: ... The extracted RNAs were treated with RNase-free DNase I (TaKaRa, Japan) to remove contaminating genomic DNAs ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Genomics 2020Quote: ... Human universal reference total RNA (Catalog No. 636538, Clontech, Mountain View, CA) was used as a template to synthesize cDNA by reverse transcription ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA reverse transcription was performed with 5 × PrimerScript RT Master Mix (Takara). qPCR was performed using a CFX Connect™ Real-Time System (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA synthesis from total RNA was done using MMLV Reverse Transcriptase (Takara) as per manufacturers instructions ...
-
bioRxiv - Microbiology 2020Quote: Total RNA from 1×106 K562 cells were extracted using Trizol (Takara) and purified with Qiagen RNAeasy mini kit (Qiagen) ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted from five samples using the Trizol method (Takara, Japan) with the addition of RNAiso-mate to remove polysaccharides and polyphenol substances ...
-
bioRxiv - Plant Biology 2020Quote: ... total RNA was extracted from leaves and purified using RNAiso Plus (TaKaRa) according to the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: The extracted RNA was treated with Recombinant DNase I (Takara Bio, Japan) to digest the remaining genomic DNA and was purified by phenol/chloroform/isoamyl alcohol (25:24:21 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated following the protocol by the Trizol kit (TAKARA). SYBR Green (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was then amplified with the SMARTer Ultra Low RNA kit (Clontech) including ERCC RNA spike-ins (ThermoFisher Scientific# 4456740) ...
-
bioRxiv - Cell Biology 2021Quote: RNAs were extracted from the lungs or cells using RNAiso Plus (TAKARA), followed by purification using NucleoSpin RNA Clean-Up kit (Macherey-Nagel) ...
-
bioRxiv - Cancer Biology 2022Quote: ... total RNA was isolated from liver of mice using RNAiso plus (TaKaRa). RNA was reverse-transcribed using the PrimeScript RT reagent Kit (TaKaRa) ...
-
bioRxiv - Immunology 2022Quote: ... Equal quantities of RNA were reverse transcribed using Primescript Reverse transcriptase (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed with the prime Script RT reagent kit (Takara). Differential regulation of cellular genes was assessed using TB Green™ Premix Ex Taq™ II (Tli RNase H Plus ...
-
bioRxiv - Cancer Biology 2022Quote: RNA-sequencing: FASTQ files were demultiplexed using a java script from Takara. FASTQ files were mapped and transcript counts were enumerated using STAR (genome version mm10 and transcript version genecode M13) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara).
-
bioRxiv - Plant Biology 2021Quote: ... The RNA was reverse transcribed into cDNA using PrimeScript (Takara Bio Inc.). qPCR was performed using Kapa SYBR FAST qPCR Master Mix (Kapa Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Extracted RNA was reverse transcribed into cDNA using a kit from Takara. qPCR was performed using the SYBR Green I supermix (BioRad ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from seeds using the Fruit-mate (Takara, Japan) and MG RNAzol (Macrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... and SMARTer RNA Unique Dual Index Kit (Takara Bio, Cat. No. 634418). Library preparation included ribosomal RNA depletion ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA was extracted from whole animals using RNAiso Plus reagent (Takara) and sequenced using NovaSeq 6000 System by Macrogen Corp ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA extraction and reverse transcription were performed using NucleoSpin (Takara, #U955C) or Picopure (Thermo ...
-
bioRxiv - Plant Biology 2022Quote: ... isolated the RNA from the last four fractions by RNAiso plus (Takara) kit ...
-
bioRxiv - Immunology 2020Quote: Total RNA from intestinal tissues was prepared using Trizol reagent (Takara, JPN) following the manufacturer’s guidelines and reverse-transcribed using a PrimeScript RT reagent Kit (Takara ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesis was performed with RNA to cDNA EcoDry Premix (Takara, 639546) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA samples were treated with DNase I (RNase-free) (Takara-cat # 2270B) to remove residual genomic DNA ...
-
bioRxiv - Immunology 2020Quote: Total RNA was obtained from cells with the use of RNAiso (TaKaRa). RT was performed with 1 μg of total RNA and ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA isolated from plants was firstly treated with DNase I (Takara) to remove DNA contamination ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated with RNAiso Plus Reagents (Takara, Dalian, Liaoning, China) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we generated RNA-Seq libraries using SMART-Seq v4 (Clontech Laboratories, Inc.) combined with the Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was reverse-transcribed using the PrimeScript RT Master Mix (Takara). RNA from 3-5 adult female whole flies was isolated using TRIzol reagent combined with Chloroform/Ethanol extraction ...
-
bioRxiv - Neuroscience 2020Quote: ... total brain or DRG RNA was obtained from Clontech (#636530 and #636150). Brain RNA was pooled from 4 Asian males ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara). Quantitative real-time PCR was performed using the Light Cycler 1.5 (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized from RNA using SMARTer PCR cDNA synthesis kit (Clontech) per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were prepared using SMARTer Stranded RNA-seq kit (Clontech #634837) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were prepared using the SMARTseq Stranded Total RNA kit (Takara Bio) with ZapR kit (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from human tissues was purchased from Clontech (catalog number 636643). Most of these samples represent pooled RNA from multiple individuals (between 2 and 63 individuals) ...
-
bioRxiv - Cancer Biology 2022Quote: ... then cDNA was synthesized without RNA purification using SMART-seq HT (Takara). For the PANC-1 cells ...
-
bioRxiv - Neuroscience 2022Quote: ... were purchased from Addgene and Genscript or amplified from human adult and fetal brain RNA (Takara) (see Table S10)(Alford et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The extracted RNA was reverse transcribed using PrimeScript RT Master Mix (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from six different tissues using Trizol reagent (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... or the SMARTer Stranded Total RNA Kit v2 - Pico Input Mammalian (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... RNA samples were reverse-transcribed using Prime Script RT Reagent kit (TaKaRa) in combination with an AS1-specific tagged primer (no ...
-
bioRxiv - Neuroscience 2022Quote: ... the SMART-Seq v4 Ultra Low input RNA kit (Takara Bio USA) was used according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with 10 μg of total RNA treated with DNase I (Takara, Japan) and purified by G-50 column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted from cells using the TRIzol reagent (Takara, Shiga, Japan) and reverse transcribed using the PrimeScript™ RT reagent Kit (Takara) ...
-
bioRxiv - Microbiology 2024Quote: ... placed in 1mL LBP from the NucleoSpin RNA Plus kit (Clontech #740984.250) with silica disruption beads and snap frozen in liquid nitrogen ...