Labshake search
Citations for Takara Bio :
1051 - 1078 of 1078 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The human WT Trop-2 and the Trop-2-Q118E mutant cDNAs [70] were amplified by PCR method (primers: F’ gcgattctcgagtccggtccgcgttcc-XhoI and R’ gcgccggtaccaagctcggttcctttc-KpnI) and sub-cloned into the pEYFP-N1 vector (Clontech, OH, USA) for mammalian expression to give the Trop-2-pEYFP-N1 and Trop-2-Q118E-pEYFP-N1 plasmids.
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: ... Transformed yeast cells were grown under selective conditions in a minimal medium (46.7 g L-1 Minimal SD Agar Base [TaKaRa] ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total protein quantification was performed by a bicinchoninic acid (BCA) assay with a BCA protein assay kit (TaKaRa Bio, Shiga, Japan) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... The genes were amplified with [AgApiTpCold_F and R] and [Agr35256-2_F and R] primer sets (Supplemental Table S1) and cloned into the NdeI/XbaI sites of the pCold ProS2 vector (Takara Bio, Kusatsu, Japan). The resulting plasmid was transformed into E ...
-
bioRxiv - Microbiology 2024Quote: ... Residual DNA and ssRNA were eliminated from the extracted nucleic acids using 2U DNase I (Simgen, Hangzhou, China) and 10U S1 nuclease (TaKaRa, Dalian, China) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The ΔPro ADAM17 (amino acid 215-824) was inserted into the pRK5M-myc expression vector behind its native signal sequence using Infusion Cloning (Takara Bio Inc.). Each expression construct was validated by Sanger sequencing.
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of each common amplicon were pooled and gel purified from a 1.5% agarose gel (Nucleospin clean-up, Takara Bio), eluting in 35 μl 10 mM Tris-HCl ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Developmental Biology 2024Quote: ... CRISPR-targeted regions in marcks.L/S and marcksl1.L/S were PCR-amplified using the EmeraldAmp GT PCR Master Mix (Takara Bio). For every gene ...
-
bioRxiv - Microbiology 2024Quote: ... pRF vectors with chimeric L-segments were constructed by in-fusion high-fidelity (HD) restriction-free cloning method (TaKaRa Bio). Two nucleotides of LF2384 L gene were different from those of parent wildtype virus and one nucleotide of LF2350 GPC gene of was different from that of wildtype one ...
-
bioRxiv - Plant Biology 2024Quote: ... and one of 15 µl purified DNA was used for real-time PCR amplification using SYBR Premix Ex Taq II (Tli RnaseH Plus) (TaKaRa) and Real-Time LightCycler 480 system (Roche ...
-
An engineered receptor-binding domain improves the immunogenicity of multivalent SARS-CoV-2 vaccinesbioRxiv - Microbiology 2020Quote: CMV/R expression plasmids encoding wtRBD or gRBD fused to multimerization platforms (Figure S3A) were prepared using NucleoBond® PC 2000 (Takara Bio USA Inc) and confirmed to be essentially endotoxin free using Pierce™ Chromogenic Endotoxin Quant (Thermoscientific ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Plant Biology 2023Quote: ... were used to co-transform yeast strain AH109 and colonies carrying both vectors were selected on SD medium without tryptophan (-W) and leucine (-L) (TaKaRa 630317) at 28°C ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA was extracted from the leaves using the Acid Phenol Guanidium Chloroform method (Chomczynski and Sacchi 2006) and was then treated with 10 U of DNase I (Takara Bio Inc., Kyoto, Japan). poly(A)+ RNA was separated and purified from total RNA using an oligo(dT ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Biochemistry 2022Quote: ... S domains and variants were purified similar to S protein using nickel resin (10 mL/L, His60 Ni2+ superflow resin, Takara cat# 635664) with wash buffer (25 mM MES ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Immunology 2023Quote: ... and used to generate Illumina-ready heavy and light chain sequencing libraries using the SMARTer Mouse BCR IgG H/K/L Profiling Kit (Takara, Cat# 634422). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.5 µl used as a source of genomic DNA in 20 µl PCR reactions with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... pDUP50M1 or pDUP51-ΔM and pDUP50-ΔM (a kind gift from D. L. Black, UCLA, USA) and pCMS-EGFP (Takara Bio USA, Inc) or pEGFP-IQGAP1 (Ren et al. ...