Labshake search
Citations for Takara Bio :
1051 - 1100 of 5917 citations for Arg8 Vasopressin AVP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... or the SMART-Seq mRNA LP Kit (Takara Bio USA) (for pre-parasitic J2 library generation) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SYBR RT-PCR Kit was purchased from Takara (Dalian, China). PHrodo-labelled E ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Bioengineering 2024Quote: ... AAV was purified with the AAVpro Purification Kit (Takara, 6666) according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... and RNA extraction kit were bought from Takara (Dalian, China). Ultrapure water was employed throughout the work ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio). The quality ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was prepared using PrimeScript cDNA Synthesis Kit (DSS Takara Bio India Pvt ...
-
bioRxiv - Cell Biology 2024Quote: ... using In-Fusion® HD Cloning Kit (Takara Bio, #639650). Subsequently ...
-
bioRxiv - Physiology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Immunology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Genomics 2020Quote: ... 20 ng of sheared DNA was used for the library construction with ThruPLEX DNA Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA). Plasma and tumor DNA libraries were sequenced using paired-end 50 bp reads generated on the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Genomics 2020Quote: The cfDNA library construction was performed with the SMARTer ThruPLEX Plasma-Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA), as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was isolated using RNAqueous isolation kit (Thermo-Fisher, Waltham MA) and mRNA reverse transcribed using PrimeScript RT Reagent Kit (Takara Bio USA, Mountain View CA). Quantitative PCR reactions were carried out using PowerUp SYBR-Green master mix using StepOne Real-Time PCR systems (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (for immunohistochemistry 1:1000, Molecular Probes; for Western blotting: 1:10000, Clontech), mouse anti-Tubulin (1:80 ...
-
bioRxiv - Neuroscience 2020Quote: ... Single labeling involved exposure of sections to 1:25,000 or 1:100,000 anti-DSRed (Takara), 1:500 anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2022Quote: ... Immunofluorescent staining was performed using primary antibodies (FOS, #2250, Cell Signaling Technology, 1:1000; GFP, GFP1020, Aves Laboratories, 1:1000; dsRed, 632496, Takara, 1:1000), antibodies were reacted with species-specific Alexa Fluor-488 ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were prepared for library prepraration using the SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian Kit for Sequencing (Takara Bio USA, Mountain View, CA). Total RNA was quantified and purity ratios determined for each sample using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Using the cDNA synthesis kit (TaKaRa: Moloney Murine Leukemia Virus Version), cDNA was synthesized from extracted RNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Transfection was carried out with CalPhosTM Mammalian Transfection Kit (Takara Bio) at a ratio of pLL3.7:psPAX2:MD2G = 20:15:6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then prepared using the PrimeScript RT reagent kit (TaKaRa). QPCR reactions were performed according to the manufacturer’s instructions using SYBR® Premix Ex Taq kit (TaKaRa) ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNAs were extracted using the RNAplus Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The amplicons were purified by DNA Amplification Clean Up Kit (Clontech). Amplicons were pooled in equimolar ratios prior to library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... the viral RNA was purified by NucleoSpin® RNA Kit (TAKARA). Recombinant INHis proteins (300 nM ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was extracted using NucleoSpin RNAII kit (Takara, Cat#740955.50). qRT-PCR was performed on 96-well optical reaction plates with one-step SYBR Green PCR master mix (Bio-Rad Laboratories ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the PrimeScript RT Reagent Kit with gDNA Eraser (TAKARA BIO). Real-time RT-PCR was performed using the THUNDERBIRD SYBR qPCT Mix (TOYOBO ...
-
bioRxiv - Evolutionary Biology 2020Quote: The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Takara) was used to generate first strand cDNA from 2.5 ng UNM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reverse transcription was performed using a PrimeScriptTM RT reagent kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sequencing libraries were constructed using ThruPLEX DNA-seq kit (Takara R400428). Sequencing was performed as described above ...
-
bioRxiv - Genomics 2022Quote: ... This was followed by a Reverse transcription reaction (SmartScribe kit Clontech) for 1 hour at 42°C and 70°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcriptase kit and PrimeSTAR Max DNA Polymerase were from TaKaRa. RiboLock RNase Inhibitor and RNase A (10 mg/mL ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were generated using the SMART-Seq Stranded Kit (Takara). This kit incorporates SMART® cDNA synthesis technology (28 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral titer was determined using the Lenti-X GoStix kit (Takara) following the manufacturer’s recommendations
-
bioRxiv - Genomics 2020Quote: ... we used the Cellartis® Hepatocyte Differentiation Kit (Takara Bio Inc.) and the Cellartis® DE Differentiation Kit (Takara Bio Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SMARTer Stranded Total RNA-Seq Kit - Pico Input (Clontech; 635005) and sequenced on the Illumina HiSeq 2500 sequencer (Illumina ...
-
bioRxiv - Immunology 2019Quote: ... Complementary DNA was obtained using Reverse Transcription Kit (Takara, Kyoto, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... and reverse-transcribed with a PrimeScript™ cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: PrimeScript RT Reagent Kit with gDNA Eraser – Perfect Real Time (Takara) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: cDNA was prepared using SMARTer Ultra Low RNA kit (Clontech Laboratories) for Illumina Sequencing following the manufacturer’s protocol ...
-
Macrophage-specific NF-kappa B activation dynamics can segregate inflammatory bowel disease patientsbioRxiv - Immunology 2019Quote: ... using a Lenti-X™ Provirus Quantitation Kit (Clontech; Oxford, UK). For in vitro stimulation ...
-
bioRxiv - Microbiology 2019Quote: ... The In-fusion HD Cloning Plus kit was purchased from Takara Bio USA ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using PrimeScript RT reagent Kit (Takara, Japan). qPCR was performed using specific primers and the SYBR Green PCR master mix (Applied Biosystems ...
-
bioRxiv - Genetics 2019Quote: ... using the In-fusion HD Cloning Kit (Clontech, Mountain View, CA). The primers used to amplify the Snail 3′-UTR were ...
-
bioRxiv - Molecular Biology 2019Quote: ... and library preparation using the SMARTer stranded RNA-seq Kit (Clontech). DNA libraries were quantified with KAPA Library Quantification Kit for Illumina (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... with SMART RACE cDNA Amplification kit (Clontech, Mountain View, California, USA) from 1 µg total RNA ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid isolation was done using Nucleobond Xtra Midi Kit (Takara #740410.50) following the manufacture’s protocol ...