Labshake search
Citations for Takara Bio :
1051 - 1100 of 2364 citations for 6 AMINO 6 DEOXY 1 2 3 4 DI O ISOPROPYLIDENE D GALACTOPYRANOSIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Freshly harvested sorted LT-HSCs were starved in PBS for 2 hours and then fixed onto RetroNectin (Clontech)-coated slides ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cell content was ejected onto 1.1 µl drop of lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µg of total RNA was subsequently reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Yeast 2-hybrid library screening was conducted using the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs], 0.625 mM each dNTP Mixture [TaKaRa] ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Genomics 2021Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountain View CA).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The 2-μg RNA sample was reverse transcribed using the PrimeScript™ RT Master Mix (Takara, Shiga, Japan). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... the cell body was immediately sucked into the glass electrode with negative pressure and expelled onto a 1.1 µl drop of the ice-cold lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Microbiology 2023Quote: HEp-2 cells were transduced with supernatants of Plat-GP cells cotransfected with pMDG60 and pRetroX-Tet3G (TaKaRa), selected with 4 mg/ml G418 (Wako) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... cultures were split into two 2-ml cultures of which one was supplemented with 250 nM rapalog (Clontech). Mislocalisation of the target protein was verified by live-cell microscopy.
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... 1 × GC buffer II and 1 U of LA Taq DNA polymerase (TaKaRa). The PCR cycles consisted of 95 °C for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... TEX12 (1-123) and SIX6OS1 (1-587) were cloned into pGADT7 vectors (Clontech). The Matchmaker™ Gold system (Clontech ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated twice in 1 ml of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... then in 1:25,000 or 1:100,000 rabbit anti DSRed (Takara Bio USA) in 10% NHS-TPBS ...
-
bioRxiv - Microbiology 2022Quote: ... and 50 ng mL−1 or 25 ng mL−1 anhydrotetracycline (aTc, Clontech) and Aeromonas sp ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Physiology 2024Quote: ... (Cx43: 1:3000 custom-produced rabbit polyclonal; eGFP: 1:1000 mouse monoclonal (Clontech Laboratories Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Purified RNA served as input for the cDNA library preparation with SMART-Seq v.4 Ultra Low Input RNA kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was carried out using a Chromo 4 detector (CFB-3240, MJ Research) and the SYBR Premix Ex Taq™ (Takara Bio Inc.) for ap or the THUNDERBIRD SYBR qPCR Mix (QPS-201 ...
-
bioRxiv - Cell Biology 2023Quote: ... MT-4 cells (gift from(Nakashima et al., 1990) were transfected with a plasmid containing LTR-driven EGFP expression plasmid (Clontech Laboratories Inc, USA) and pFX2 (Invitrogen Corporation ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... (1:1000 anti GAPDH) (1:1000 anti-TdTomato rabbit primary antibody #632496 from Takara).
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...