Labshake search
Citations for Takara Bio :
1001 - 1050 of 2428 citations for Ethyl 5 1 3 dioxolan 2 yl 2 thiophenecarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pRetroX-TRE3G (TaKaRa). pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+ ...
-
bioRxiv - Microbiology 2023Quote: ... pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Molecular Biology 2023Quote: ... linearized by PCR and using the divergent primers reported in Supplementary Table 3 and CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (23) ...
-
bioRxiv - Microbiology 2022Quote: ... and 3′ sequences (3F) flanking the gene ORF were amplified from Ct3 genomic DNA by PrimeSTAR HS DNA polymerase (TaKaRa). The purified PCR products 5F and 3F were mixed with SalI-treated pBIG4MRHrev for In-Fusion reactions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expression vector was produced by inserting the cDNA encoding the Rhino fragment into pGEX-5X-3 (Cytiva) by Infusion (Takara). The primers used are listed in Supplementary Table 1.
-
bioRxiv - Microbiology 2024Quote: ... and HHT1_U and HHT1_L for HHT1 (Table 3) using SYBR® Premix Ex TaqTM (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described;86 (ii ...
-
bioRxiv - Microbiology 2022Quote: ... 10 ng of linearized pDEST32 empty vector was co-transformed with 3 μl of PCR product to achieve recombinational cloning by gap-repair in Y2H Gold yeast strain (Clontech) expressing AD-fused CP204L (pPC86 vector) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2017) into the 3’ end of AQP1 in pBS-AQP1 (described above) using the In-Fusion Cloning system (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Full-length and N-terminally deleted versions of HaloTag-hCAP-H vectors were constructed by fusing the 3’ ends of the corresponding cDNAs with a HaloTag fragment using In-fusion HD Cloning Kit (TaKaRa). The following primers were used the construction of these HaloTag-hCAP-H vectors ...
-
bioRxiv - Microbiology 2022Quote: ... sacB was amplified using pAJF067 as a template and primers listed in Supplementary Table 3 and were cloned into pDB60 digested with EcoR1 using recombination based cloning (In-Fusion, Takara). For dinB2 and dinB3 overexpression plasmids constructs ...
-
bioRxiv - Cell Biology 2024Quote: ... where RapA(wt) was amplified from AX2 cDNA and inserted into pGBKT7 (Matchmaker™ GAL4 Two-Hybrid System 3, Clontech) using BamHI/PstI sites ...
-
bioRxiv - Microbiology 2024Quote: ... The expression profile of target gene was evaluated using specific primers (Table-3) by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified plasmid backbone linearized with PmeI was assembled with 3’UTR inserts using InFusion Snap Assembly Master Mix (Takara #638947) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, gal80Δ, met-, URA3::GAL1UAS-Gal1TATA-LacZ, MEL1; TaKaRa), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (51) ...
-
bioRxiv - Bioengineering 2020Quote: ... were mixed at a 1:1:1 ratio and bound to retronectin (Clontech)-coated plates according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:200-1:500, Clontech), mouse anti-1D4 anti-Fasciclin II (1:10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... doxycycline (DOX, 1 µg ml−1, Takara Bio) and 2% penicillin–streptomycin (Gibco) ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Full-length RNA-seq libraries from CM and skin macrophages were prepared from ∼3 ng of total RNA using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) followed by Nextera XT protocol (Illumina) ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
bioRxiv - Genomics 2020Quote: ... was linearized from the 3’LTR to the RRE by PCR and both PCR products were fused using In-Fusion Cloning (Takara Bio) and transformed into One Shot Stbl3 Chemically Competent E.coli (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... These identical sequences were generated via PCR with primers that contain a 5’ end identical to an adjacent segment and a 3’ end that anneals to the gene-of-interest sequence using a 2x hot-start PCR master mix (Takara, #R405A). The primers for PCR reactions were listed in Table 2.
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Promoterless bicistronic vectors were generated by removing the SV40 promoter from the bicistronic vector pRUF and the pRUF vectors containing the putative IRES sequences by PCR amplification using divergent primers (Supplementary Table 3) and the CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Neuroscience 2023Quote: ... the SV40pA was replaced by the 3’UTR of msSOD2 (Kaltimbacher et al., 2006) amplified from mouse brain cDNA (Clontech 637301) using primers AA35 and AA36 and inserted into the XbaI and NotI sites ...
-
bioRxiv - Neuroscience 2023Quote: Artificially synthesized (G4C2)50 sequences flanked at the 5′ end with an EagI recognition site and at the 3′ end with a PspOMI recognition site were subcloned into T-vector pMD20 (Takara Bio). To generate a longer repeat size ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesis of cDNA with biotinylated 3’ adaptor ligation was performed using a Small RNA Cloning Kit (Takara Bio Inc., Kusatsu, Japan) as previously reported (20 ...
-
bioRxiv - Neuroscience 2022Quote: Jacob-LMO4 interaction was reconfirmed using fusion vectors (bait vector pGBKT7, prey vector pGADT7) using MATCHMAKER Two-Hybrid System 3 (Takara Bio Europe/Clontech, France). Co-transformed yeasts were assayed for growth on quadruple drop-out medium (SD/–Ade/–His/–Leu/–Trp ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe Reverse Transcriptase (Takara ClonTech #639538) as described92 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three RNA lysis aliquots of the LC6 sample were processed and library preparation completed on the 3 aliquots with SMART-Seq® HT Kit (Takara) and Illumina Nextera reagents for tagmentation ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by selection of transformants and testing of pair-wise interactions by growth complementation assays on nutrient selection media as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To compensate for auto-activation of some constructs ...