Labshake search
Citations for Takara Bio :
1001 - 1050 of 2457 citations for E 6 2 6 6 Trimethylcyclohex 2 en 1 yl hex 5 ene 2 4 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the membrane was incubated overnight at 4°C with an anti-GFP monoclonal primary (JL-8; Clontech 632381) at 1:5,000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 μg of total RNA was used for cDNA synthesis with PrimeScript 1st strand cDNA Synthesis Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:200-1:500, Clontech), mouse anti-1D4 anti-Fasciclin II (1:10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... doxycycline (DOX, 1 µg ml−1, Takara Bio) and 2% penicillin–streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pre-cleared by centrifugation at 1000xg for 5 min and concentrated by 40X using Lenti-X (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PGCs and EGCs were lysed at room temperature for 5 minutes in lysis buffer (Takara Bio, #635013) containing RNAse inhibitors (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara) and cDNA synthesized with SuperScriptIII (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB] ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the supernatant was loaded onto a 5 ml column with prewashed Talon resin (Clontech Laboratories, Inc, CA). The column was washed three times with the low pH buffer (pH 6.3) ...
-
bioRxiv - Microbiology 2024Quote: Sequencing of variable heavy and kappa chains was obtained using SMARTer 5’ RACE technology (Takara Bio USA) adapted for immunoglobulins to amplify the variable genes from the heavy and kappa chains ...
-
bioRxiv - Molecular Biology 2024Quote: ... while amplicons over 5 kb were produced using PrimeStar GXL polymerase (Takara Bio, San Jose, CA, #R050A) in a two-step amplification reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cDNA was amplified using 5’UTR Myc specific forward and reverse primers using PrimeStar Max (Takara) for 35 cycles using ∼20% of purified cDNA product ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Neuroscience 2020Quote: ... before addition of 4 mM imidazole and incubation on a rotor (111 RPM) with TALON metal affinity resin (Takara, Cat.# 635503 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cell lysate was centrifuged at 40,000 × g for 45 min at 4 °C and the supernatant was loaded onto a cobalt affinity column (Clontech). After washing the column with 20 bed volume of 20 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was clarified at 26,915 x g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Nsp15 was eluted from the resin with 250 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μL of 10 × PCR Buffer (Mg2+ plus) provided with the TAKARA Taq™ Hot Start Version (TAKARA, Japan), 0.08 μL of TransScript® Reverse Transcriptase [M-MLV ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was clarified at 26,915 × g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Thrombin-TEV-Nsp15 variants were eluted with 250 mM imidazole and further purified by gel filtration on a Superdex-200 column (GE Healthcare ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Pathology 2023Quote: ... Cells were harvested by centrifugation at 4,000 rpm for 20 min at 4℃ and resuspended in 20 ml xTractor buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... Cells were harvested by centrifugation at 4,000 rpm for 20 min at 4℃ and resuspended in 20 ml xTractor buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Microbiology 2024Quote: ... the expression of GFP11-tagged IncB or OmpA was induced by the addition of 4 ng/ml anhydrotetracycline (Clontech) at 0-2 hpi.
-
bioRxiv - Immunology 2024Quote: Total RNAs were isolated from wild-type or ctla-4-/-intestines (three biological replicates) using TRIzol reagent following the manufacturer’s instructions (Takara). cDNA libraries were constructed using NEB Next Ultra Directional RNA Library Prep Kit (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-linked (1:2000, Takara, japan, Cat#T7122A-1);
-
bioRxiv - Molecular Biology 2021Quote: ... HRP-linked (1:2000, Takara, Japan, Cat# T7122A-1).
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit anti-dsRed (Takara 632496, 1:1,000–1:2,000), and Chicken anti-GFP (Aves GFP-1020 ...
-
bioRxiv - Neuroscience 2024Quote: ... primary antibody staining (ALDH1L1, Abcam #ab871170 1:250; S100B, Synaptic Systems #287006 1:250; GFP, Abcam #ab13970 1:1000; Stem121, Takara #Y40410 1:500) was performed in staining buffer (2% normal horse serum ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Cancer Biology 2020Quote: ... three replicate wells of 5□×□104 cells per well were seeded in a retronectin (Takara Bio Inc, JPY) coated 24-well XF24 plate ...