Labshake search
Citations for Takara Bio :
1001 - 1050 of 1390 citations for 8 8 dimethylpyrano 2 3 h chromen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and quantified by RT‒qPCR using Primer/Probe N2 (NIHON GENE RESEARCH LABORATORIES, INC. Miyagi, Japan) and One Step PrimeScript™ III RT‒qPCR Mix (TaKaRa) with CFX96 (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... 90 μl of RNase free water was added and then 2.5 μl of diluted sample was used for real-time RT-PCR according to the manufacturer’s protocol with One step TB green PrimeScript PLUS RT-PCR Kit (Takara, Cat# RR096A) and primers for Nucleocapsid (N ...
-
bioRxiv - Microbiology 2023Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Zoology 2024Quote: ... RNA was extracted using Isogen-LS (Nippon Gene) and RT-qPCR was performed using the One-Step PrimeScript RT-PCR Kit (Takara Bio) on a 7500 Real-Time RT-PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were infected with concentrated lentivirus for 24 h in wells pre-coated with Retronectin (0.2 mg/ml; Takara) in expansion medium supplemented with protamine sulfate (10 μg/ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 50°C for 1hr followed by incubation with 0.5U/μL T4 RNase H at 37°C.The libraries were generated by PCR using LA Takara taq polymerase (Clontech) and oligos P5 and PE (see Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA samples were subjected to real-time PCR with SYBR Premix Ex Taq Tli RNase H Plus (Takara) using an ABI 7500 Fast Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time quantification PCR was performed using the SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara, Japan) with the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was subsequently used for real-time qPCR using TB Green Premix Ex Taq (Tli RNase H Plus) (Takara). Viral RNA from nasal washes was also used for whole viral genome sequencing ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Supernatant containing virus was collected 48 h later and 10-X concentrated using Lenti-X Concentrator (Takara Bio, Germany). AML-12 wild-type cells were transduced using concentrated virus and selected using 3 μg/mL of puromycin ...
-
bioRxiv - Microbiology 2024Quote: ... Lentiviral supernatant was harvested 48 h later and then filtered to be concentrated through a Lenti-X Concentrator (Takara) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: One µg of total RNA was used to generate cDNA with the SMARTer PCR cDNA Synthesis kit (Clontech, Mountain View, CA, USA). Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems ...
-
bioRxiv - Pathology 2020Quote: The viral loads of WHCV in BALF of patient 1 were determined by quantitative real-time RT-PCR with Takara One Step PrimeScript™ RT-PCR Kit (Takara RR064A) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... LINC00662 (NR_027301) and ELK4 (NM_001973.4) were detected by One-Step SYBR PrimeScript RT-PCR Kit (Perfect Real Time; Takara Bio, Inc., Kusatsu, Japan). Relative expression values were calculated using the relative quantification (2−△△Ct ...
-
bioRxiv - Plant Biology 2020Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA were amplified from the embryo RNA using PrimeScript™ II High Fidelity One Step RT-polymerase chain reaction (PCR) Kit (Takara, R026A) using the following primers ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Immunology 2022Quote: ... The day before transduction, a non-tissue culture treated 24-well plate (Grener Bio one, #662102) was coated with retronectin (Takara Bio, #T100B) in PBS (7μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: The MDM4 coding sequence (NM_002393.5) was cloned into Lenti-X™ Tet-One™ Inducible Expression System (Takara Bio, cat. no. 631847). The resulting plasmid was then subject to whole-plasmid sequencing for verification ...
-
bioRxiv - Microbiology 2023Quote: ... levels were measured by a qRT-PCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A). The PCR protocol was 42°C for 5 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The expression of marker genes was detected by qRT-PCR using the One-step TB Green PrimeScriptTM RT-PCR kit II (Takara, Osaka, Japan). All genes were normalized against the level of an actin reference gene (Foo et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Genomics 2024Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA copy numbers of each virus stock were measured via RT-qPCR assay with the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A) as described previously [12] ...
-
bioRxiv - Genetics 2024Quote: ... GFP-fused Actb WT and S348L in pcDNA3-GFP were amplified using KOD One (TOYOBO, Osaka, Japan) and cloned into pCSf107mT[31] using the In-Fusion HD Cloning Kit (Takara, Shiga, Japan) resulting in pCSf107mT-GFP-Actb WT and S348L ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time quantitative PCR was performed in triplicate using the SYBR Premix Ex Taq (Tli RNase H Plus) kit (Takara). The expression of TBP was used for the normalization of mRNA expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of these mRNAs was assayed using TB Green™ Premix Ex Taq™ II (Tli RNase H Plus; Takara) according to manufacturer’s instructions with QuantiTect primer assays (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... qPCR was carried out using TB Green Premix Ex Taq (Tli RNase H Plus) (#RR420A, Takara Bio Inc., Kusatsu, Japan) and the Applied Biosystems StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... qPCRs were carried out using TB Green Premix Ex Taq (Tli RNase H Plus) (#RR420A, Takara Bio Inc., Kusatsu, Japan) and the Applied Biosystems StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...