Labshake search
Citations for Takara Bio :
1001 - 1050 of 2788 citations for 6 4 METHOXY PHENYL 3 METHYL IMIDAZO 2 1 B THIAZOLE 5 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... MEL1 and lacZ) under distinct GAL4 upstream activating sequences as described in Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual (Clontech). The transformants were grown on synthetic dropout (SD ...
-
bioRxiv - Genomics 2019Quote: SiGRF1 protein interactions were investigated by screening a foxtail millet cDNA library in yeast with the Matchmaker Two-Hybrid System 3 (Clontech). SiGRF1 cDNA without the termination codon was cloned with EcoR1 technology in pGBKT7 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA was generated through a 3’-RACE-Ready cDNA synthesis reaction using the SMARTer RACE cDNA amplification kit (Clontech), following the user manual ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: For testing protein-protein interactions Matchmaker™ GAL4 Two-Hybrid System 3 was used according to the manufacturer’s instructions (Clontech). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... 10 ng of linearized pDEST32 empty vector was co-transformed with 3 μl of PCR product to achieve recombinational cloning by gap-repair in Y2H Gold yeast strain (Clontech) expressing AD-fused CP204L (pPC86 vector) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2017) into the 3’ end of AQP1 in pBS-AQP1 (described above) using the In-Fusion Cloning system (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Full-length and N-terminally deleted versions of HaloTag-hCAP-H vectors were constructed by fusing the 3’ ends of the corresponding cDNAs with a HaloTag fragment using In-fusion HD Cloning Kit (TaKaRa). The following primers were used the construction of these HaloTag-hCAP-H vectors ...
-
bioRxiv - Microbiology 2022Quote: ... sacB was amplified using pAJF067 as a template and primers listed in Supplementary Table 3 and were cloned into pDB60 digested with EcoR1 using recombination based cloning (In-Fusion, Takara). For dinB2 and dinB3 overexpression plasmids constructs ...
-
bioRxiv - Microbiology 2022Quote: ... and 3′ sequences (3F) flanking the gene ORF were amplified from Ct3 genomic DNA by PrimeSTAR HS DNA polymerase (TaKaRa). The purified PCR products 5F and 3F were mixed with SalI-treated pBIG4MRHrev for In-Fusion reactions ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described;86 (ii ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expression vector was produced by inserting the cDNA encoding the Rhino fragment into pGEX-5X-3 (Cytiva) by Infusion (Takara). The primers used are listed in Supplementary Table 1.
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Microbiology 2024Quote: ... and HHT1_U and HHT1_L for HHT1 (Table 3) using SYBR® Premix Ex TaqTM (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Neuroscience 2023Quote: The high-quality human total brain RNA that was used for 3’ RACE was purchased from Clontech (Mountain View, CA). SCA12 KI-10 and KI-80 mouse models were generated using the CRISPR/Cas9 approach by replacing the mouse PPP2R2B exon 2 with the human PPP2R2B exon 7 containing either 10 or 80 CAG triplets (Li and Margolis ...
-
bioRxiv - Synthetic Biology 2023Quote: Plant cDNA was prepared from 3 μg of each leaf RNA sample via RNA to cDNA EcoDry Premix (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The Kpn I – BamHI env fragments from the pSVIIIenv plasmids were cloned into the corresponding sites of pE7SB-NL4-3 using Long Ligase (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (23) ...
-
bioRxiv - Microbiology 2023Quote: ... pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Molecular Biology 2023Quote: ... linearized by PCR and using the divergent primers reported in Supplementary Table 3 and CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Microbiology 2023Quote: ... by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pRetroX-TRE3G (TaKaRa). pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+ ...
-
bioRxiv - Microbiology 2024Quote: ... The expression profile of target gene was evaluated using specific primers (Table-3) by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (51) ...
-
bioRxiv - Cell Biology 2024Quote: ... where RapA(wt) was amplified from AX2 cDNA and inserted into pGBKT7 (Matchmaker™ GAL4 Two-Hybrid System 3, Clontech) using BamHI/PstI sites ...
-
bioRxiv - Bioengineering 2020Quote: ... were mixed at a 1:1:1 ratio and bound to retronectin (Clontech)-coated plates according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 μg was used as template for cDNA synthesis using Smart MMLV reverse transcriptase (Clontech). All cloning PCRs were performed with an initial denaturation at 94 °C for 2.5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: Complete cDNA was synthesized from 5 ng total RNA using the SmartScribe reverse transcriptase (Takara Bio) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the membrane was incubated overnight at 4°C with an anti-GFP monoclonal primary (JL-8; Clontech 632381) at 1:5,000 dilution ...
-
bioRxiv - Genetics 2019Quote: ... following 0.5 mM IPTG induction for 4 h at 25°C with subsequent purification using TALON chromatography (Clontech) as described 34 ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... using the manufacturers protocol and amplified using SMARTer Ultra Low Input RNA kit for sequencing (version 4, Clontech). Sequencing libraries were generated using TruSeq Nano DNA Sample Preparation kits (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 μg of total RNA was used for cDNA synthesis with PrimeScript 1st strand cDNA Synthesis Kit (Takara), according to the manufacturer’s instructions ...