Labshake search
Citations for Takara Bio :
1001 - 1050 of 1234 citations for 3' 5' Dimethyl 3 2 3 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2.6 x 106 yeast transformants were screened on 2% SD/Gal/Raf/X-P-gal (-Ura/-His/-Trp/-Leu) following the manufacturer’s instructions (Clontech). Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100 [Nacalai Tesque], 0.7 μL of 2% bovine serum albumin [BSA] [Takara Bio]) and incubation at 70°C for 90 sec to quench the denaturing effect of SDc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... The protein-bead mixtures were then loaded onto a gravity column (TALON 2 mL Disposable Gravity Column, Takara #635606). Lysate was loaded into the column 5 times with gravity flow and then washed in a 1M NaCl buffer 3 times ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... CHO-K1 cells were transiently co-transfected with 2 µg KV4.3 (cloned into pBK- CMV vector, amplified by PCR and ligated into pmCherry-C1 (Clontech), by using XhoI and HindIII restriction sites,23 and 1 µg KChIP2 (cloned into IRES mCherry KChIP2 using XbaI and XhoI restriction sites).
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by incubation at 37°C for 1 hour with 2 µl of Klenow Fragment (Takara Bio Inc, Japan) and inactivation at 65°C for 5 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pdum-Lox2 and Avi-Post2 the SMART™ (Switching Mechanism At 5’ end of the RNA Transcript) RACE method (SMART™ RACE cDNA amplification kit, Clontech) was used (Brena et al. ...
-
bioRxiv - Immunology 2021Quote: TCR cDNA libraries for high-throughput sequencing were prepared by 5’rapid amplification of cDNA ends (RACE) using the SMARTScribe™ Reverse Transcriptase (Clontech, USA) as previously described (39 ...
-
bioRxiv - Neuroscience 2021Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... Single colonies grown on selection plates were inoculated in 5 ml of SD-Leu-Trp overnight at 28 °C (ST0047, Takara Bio, USA). Saturated culture was then used to make serial dilutions of OD600 1 ...
-
bioRxiv - Microbiology 2020Quote: ... 30 sec polymerase activation at 98 °C followed by 30 cycles of 15 sec denaturing at 98 °C and 5 min annealing and extension at 65 °C (or variable values in gradient mode) in Thermal Cycler Dice ® (Takara Bio). The PCR products in Pool 1 and 2 reactions for same clinical samples were combined and purified with 1X concentration of AmpureXP.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained on the dishes at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries from 5 ng total RNA were prepared using the SMARTer® Stranded Total RNA-Seq Kit (Takara Bio USA, #635005), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM DTT) supplemented with Pierce Protease Inhibitors EDTA-free (PIA32955) and Pierce Phosphatase Inhibitors (PIA32957) and RNase inhibitor (TaKaRa, cat# 2313A), and harvested by scraping ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% SDS and supplemented with Pierce Protease Inhibitors EDTA-free (PIA32955) and Pierce Phosphatase Inhibitors (PIA32957) and RNase inhibitor (TaKaRa, cat# 2313A) and 1 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.5 μl used as a source of genomic DNA in 20 μl PCRs with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). The amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Three transformation reactions were performed with 2 µl of the reaction mixture in 50 µl Stellar− Competent Cells (636763, Takara) each according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Microbiology 2021Quote: 293T were transfected with full length SARS-CoV-2 Spikes and a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) using the calcium-phosphate method ...
-
bioRxiv - Cell Biology 2021Quote: Interactions between CDK-2 and COSA-1 were assayed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech PT4084-1). CDK-2 and COSA-1 cDNAs were amplified from a C ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression of shRNA targeting and knocking-down Eklf was induced by the addition of 2 µg/ml of doxycycline (Clontech) for 96 hr ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... PreS2-LHBS sequence (deletion nucleotides 2-55) was cloned into the protein stability construct after the c-terminal of EGFP by In-Fusion cloning (Takara). The protein stability construct was a kind gift from Dr ...
-
bioRxiv - Microbiology 2022Quote: ... Each of these prey plasmids and previously constructed bait plasmids were co-transformed into Y2HGold yeast strain using Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformation mix was spread on DDO/X and QDO/X/A agar plates and incubated at 30°C for 3-5 days ...