Labshake search
Citations for Takara Bio :
951 - 1000 of 1273 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 2 µg of total RNA using PrimeScript RT Master Mix (Takara), and expression of the indicated genes was analyzed by quantitative RT-PCR using the CFX Opus 96 Real-Time PCR System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... Second strand synthesis and PCR amplification was performed by adding Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... the virus-containing medium was filtered and concentrated with Retro-X Concentrator (Clontech, PT5063-2) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... corresponding primers (Supplementary Table 3-4), Phanta Max Super-fidelity DNA Polymerase (Cat. No. P505-d1, Vazyme) or KOD plus (Cat. No. F0934K, Takara, Kyoto, Japan) with a touchdown cycling protocol that contains 30 cycles of 98 °C for 10 s ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Immunology 2021Quote: ... The TSO was designed with two isodeoxynucleotides at the 5’ end to prevent TSO concatemerization and three riboguanosines at the 3’ end for increased binding affinity to the appended deoxycytidines (property of the Takara reverse transcriptase) (56 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were loaded into each well of a 384-well plate (A1 through D2) and dispensed 50nL per well into a 5,184 well SMARTer™ ICELL8® 3’ DE Chip (Takara Bio) using the ICELL8® Multisample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ICELL8® 3’ DE Chip was placed on the ICELL8® MSND and loaded 50 µL of RT-PCR solution (Takara Bio ...
-
bioRxiv - Immunology 2021Quote: ... viral stocks were concentrated by adding supernatant at a 3:1 ratio to Lenti-X Concentrator (631232, Takara Bio, Mountain View, CA). Mixtures were incubated overnight at 4 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... The yeast strain AH109 was used for the yeast two-hybrid assay according to MatchmakerTM Two-Hybrid System 3 (Clontech, Palo Alto) and grown on YPD (full medium ...
-
bioRxiv - Plant Biology 2021Quote: Yeast two-hybrid techniques were performed according to the yeast protocols handbook and the Matchmaker GAL4 Two-hybrid System 3 manual (both Clontech, Heidelberg, Germany) using the yeast reporter strains AH109 and Y187 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Plant Biology 2022Quote: Direct protein-protein interaction was tested by Y2H technique according to the yeast protocols handbook and the Matchmaker GAL4 Two-hybrid System 3 manual (both Clontech, Heidelberg, Germany). Yeast strain Y190 was co-transformed with respective plasmids ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNAs were synthesized using 3 µg each of the total RNA and PrimeScript 1st strand cDNA synthesis kit (Takara, Kusatsu, Shiga, Japan). Exon spanning primes were made ...
-
bioRxiv - Plant Biology 2024Quote: Yeast two-hybrid techniques were performed according to the yeast protocols handbook and the Matchmaker GAL4 Two-hybrid System 3 manual (both Clontech, Heidelberg, Germany) using the yeast reporter strains AH109 and Y187 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe Reverse Transcriptase (Takara ClonTech #639538) as described92 ...
-
bioRxiv - Evolutionary Biology 2023Quote: The 3’UTR sequence of CcTRPM gene was amplified by the 3’-Full RACE Core Set with PrimeScriptTM RTase kit (Cat# 6106, Takara, Kyoto, Japan). miRNAs for CcTRPM were predicted by a service provider LC science with two software programs of miRanda (http://www.microrna.org ...
-
bioRxiv - Microbiology 2023Quote: ... The cleared lysate was loaded onto a 25 mL free-flow gravity column (GeneFlow) packed with 3 ml TALON® Metal Affinity Resin (Takara Bio), washed with 10 column volumes (CV ...
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Cancer Biology 2024Quote: ... The wild-type AKT1 (NM_001014431.2) was cloned in the pECMV-3×FLAG-N vector using the In-Fusion® HD Cloning Kit (Takara Bio, Cat# 639650). The K20R and K20Q mutant AKT1 plasmids were constructed using the Fast Site-Directed Mutagenesis Kit (TIANGEN ...
-
bioRxiv - Developmental Biology 2024Quote: RNA extraction was performed on whole flies (3 samples per group) using Trizol-chloroform (RNAiso Plus-TaKaRa 99108, Chloroform 99.5% SRL-84155). cDNA was synthesised using the Takara PrimeScript™ RT Reagent Kit (Perfect Real Time ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 μL of PBS including 0.2% Triton X-100 and 4U of RNase inhibitor (Takara) per well ...
-
bioRxiv - Cancer Biology 2021Quote: Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...