Labshake search
Citations for Takara Bio :
51 - 100 of 693 citations for Recombinant Human ABHD15 His tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-His (1:5000, #631212, Takara), anti-Erk1/2 (1:2000 ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... EGFP tagged construct was generated in pEGFP-N1 (Clontech).
-
bioRxiv - Microbiology 2022Quote: ... Western blots using Anti-His primary antibody (Clontech) (1:4000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Plant Biology 2020Quote: ... 3-μL aliquots of each dilution were used to inoculate SD/−Trp/−His/−Ade medium and SD/−Trp/−His medium with X-α-Gal (Clontech). The inoculated media were incubated for 4 days at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Immunology 2021Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Recombinant RNase Inhibitor (Takara, Japan) were added into the cell pellets ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant Ribonuclease Inhibitor (Takara), and 10 U/μL Enzscript Moloney-Murine Leukemia Virus Reverse Transcriptase (Enzymatics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Molecular Biology 2023Quote: ... sfGFP-tagged proteins were visualized with monoclonal anti-GFP (Takara). Anti-Sty1 polyclonal antibody (Jara et al ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP tagged Pol η was expressed from pEGFP-C1 (Clontech), that we firstly modified by addition of an SV40 nuclear localization signal (ATGCCAAAGAAGAAGCGAAAGGTA GCAGATCCA ...
-
bioRxiv - Biochemistry 2023Quote: ... Expression plasmids for other His-mCherry or His-GFP fusion proteins were constructed using in-Fusion HD Cloning Kit (Takara Bio, Inc.). All mCherry/GFP fusion proteins were expressed in E ...
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
bioRxiv - Plant Biology 2020Quote: ... Ade and His but containing X-α-gal (Clontech) and 10 mM 3-amino-1,2,4-triazole (3-AT) ...
-
bioRxiv - Bioengineering 2020Quote: ... and –His/–Trp/–Ura dropout supplement (Clontech, cat. 630424). Colonies were grown in SD/–His/–Trp/–Ura medium for one night at 30 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... SD-Trp-Ura or SD-His-Leu (Clontech Takara).
-
bioRxiv - Synthetic Biology 2023Quote: ... SD-Trp-Ura or SD-His-Leu (Clontech Takara).
-
bioRxiv - Molecular Biology 2023Quote: ... GST-tagged protein was eluted with 6ml glutathione (10mg/ml, Takara) and the flow-through was collected ...
-
bioRxiv - Cell Biology 2023Quote: ... His6-tagged proteins were purified with Talon metal affinity resin (Clontech) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 160 μl recombinant RNase inhibitor (Takara Clonetech), 1.6 ml of 10 mM dNTP (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... and treated with recombinant DNase I (Takara). The treated RNA was purified with an RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... 160 µL recombinant RNase inhibitor (Takara Clonetech), 1.6 mL of 10 mM dNTP (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.2U/ml Recombinant ribonuclease inhibitor (Takara, #2313B). A second centrifugation (same conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.025 μL recombinant RNase inhibitor (Takara, 2313B), 0.04 μL reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.02 μL recombinant RNase inhibitor (Takara, 2313B) and 2.21 μL nuclease-free water per reaction (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 1.6 U Recombinant RNase Inhibitor (Takara, Japan), 0.5 μM random hexamer (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1ul recombinant RNase inhibitor (Takara, 2313B) incubated on ice for 5min ...
-
bioRxiv - Immunology 2023Quote: ... and 5U of Recombinant RNAse inhibitors (Takara), and then were washed in 1x PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with recombinant DNase I (Takara). The treated RNA was subsequently purified using an RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... 0.8 U/μl recombinant RNase inhibitor (Takara)] and incubated at room temperature for 10 min ...
-
bioRxiv - Immunology 2024Quote: ... recombinant RNase inhibitor (1 U/uL, Takara), SMARTScribe reverse transcriptase (5 U/uL ...
-
bioRxiv - Genomics 2024Quote: ... 20 U of Recombinant RNase Inhibitor (Takara), and RNase-free water to a final volume of 10 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleavage of the His-tag by HRV3C protease (Takara, 7360) followed the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... downstream of the His tag with In-Fusion HD (TaKaRa). The Gly172Phe substitution was induced by site-directed mutagenesis.
-
bioRxiv - Molecular Biology 2022Quote: ... downstream of the His tag with In-Fusion HD (TaKaRa). The His154Gly substitution was induced by site-directed mutagenesis.