Labshake search
Citations for Takara Bio :
51 - 100 of 279 citations for N 4 Hexyloxy phenyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the wild-type CARD14 insert with N-terminal 3xFLAG tag was cloned into pBApo-EFalpha Pur DNA (Takara Bio) whose EF-1α promoter was replaced by TRE3G promoter obtained from pTRE3G (Clontech) ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Plant Biology 2022Quote: ... the N-terminal part is subject to self-activation in yeast64) inserted into pDONR221 were recombined into pGBKT7 (Clontech) to obtain BD- RGA ...
-
bioRxiv - Biochemistry 2022Quote: ... N-terminal Flag-tagged P38α containing 3C protease site was amplified by PCR using CloneAmp HiFi PCR Premix (Takara) and ligated in to pcDNA3 using the aforementioned restrictions sites ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... or into pHTN-HaloTag vector for GID4-HaloTag N-terminal fusion using the In-Fusion HD Cloning kit (Takara). Pro/N-degron coding sequence was cloned into pNLF1-C for MPGLWKS-NanoLuc C-terminal fusion ...
-
bioRxiv - Molecular Biology 2022Quote: ... red fluorescence protein (DsRed) and NK-NT or NKN1 fragments were cloned into pET6xHN-N Vector (Takara, CA, USA). HEK293T cells were cultured in FP medium (DMEM containing 10% FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... DLK and DRP1 were N-terminally tagged into a GST-containing backbone using In-fusion cloning (Takara Bio. 638945). Cyto-mAPPLE plasmid was a gift from Michael E ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Immunology 2024Quote: ... and RNAse inhibitor (4 units) (Takara Bio, London, UK). After each plate was filled ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 ml TALON cobalt resin slurry (Takara Bio Inc.) was added (1 ml/tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Cell Biology 2020Quote: ... the sequence of NAGTI-GFP (N-acetylglucosaminyltransferase I fused to GFP; (Shima et al., 1997)) was cloned into pLVX-TetOne-Puro (Clontech). The constructed plasmid was then co-transfected with psPAX and pVSVG into HEK293T cells to produce lenti-viruses ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x) ...
-
bioRxiv - Cell Biology 2021Quote: ... an additional set of genes encoding pTF.CREG1 with N-terminal truncations (Δ26, Δ31, Δ39, Δ43) was generated by PCR using PrimeStar GXL DNA Polymerase (Takara Bio), primer sets JT33/JT32 ...
-
bioRxiv - Biophysics 2021Quote: ... AY457063.1) and PIKfyve-KYA hyperactive mutant (E1620>K, N1630>Y, S2068>A) were cloned into PCMV-HA-N vector (Clontech) and gifted by Lois Weisman lab ...
-
bioRxiv - Biophysics 2023Quote: ... A plasmid expressing mouse GR tagged in the N-terminus with mCherry was developed by amplifying mouse GR coding sequence and in-frame cloning in pmCherry-C3 (Clontech). Point mutations and deletions were introduced using the Quickchange XL mutagenesis kit (Agilent ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... and a single transmembrane region from human IL2RA (UniProt accession number: P01589) were fused to the N-terminus of KCNQ2 or KCNQ3 using the In-Fusion HD Cloning Kit (Takara). Site-directed mutations were introduced into KCNQ2 and KCNQ3 by standard PCR techniques using PrimeSTAR Max DNA Polymerase (Takara) ...
-
bioRxiv - Cell Biology 2024Quote: ... full-length IQGAP1 was tagged at the N terminus with tandem enhanced green fluorescent protein (EGFP) and inserted into pEGFP-C1 (Clontech) at a BglII and SmalI site ...
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Genomics 2020Quote: ... with a flag tag at the N terminal and an EGFP tag at the C terminal by the In-Fusion HD Cloning system (TaKaRa, 638909). After transfection of the U2OS cells with the pCMV-Tet3G Vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full-length WDR5 was cloned in frame as N- or C-terminal NanoLuc-fusion pNLF1 vector using ligation independent in-fusion cloning (Takara Bio) and sequence verified ...
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Genetics 2020Quote: ... The amplified fragment was cloned into the AscI site of pBM61::CCGp-N-3xFLAG (80) by InFusion cloning (Takara, cat. # 639648). The new plasmid was then digested with DraI and transformed into a his-3;mus-52::bar strain ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Biochemistry 2023Quote: ... 425 – 658) and SipAC-Core (a.a. 512 – 658) were cloned with an N-terminal 6xHis-tag into pColdI vector (Takara Bio USA) modified to include a tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid was used to generate N-terminal-truncated MGME1 (ΔN-MGME1; residues 95 to 344) by means of In-Fusion Cloning (Takara Bio). Constructs expressing the MGME1 variants used in this study were generated by site-directed mutagenesis using the pSol-His8-SUMO-MGME1 plasmid as template ...
-
bioRxiv - Microbiology 2024Quote: B263R was amplified from gDNA of ASFV and cloned separately into vectors pCMV-Flag-N (635688; Clontech, Mountain View, CA, USA), pCMV-Myc-N (635689 ...
-
bioRxiv - Cell Biology 2022Quote: ... ACLY lentivirus constructs were generated by inserting ACLY variants with an N-terminal MYC tag into pLVX-IRES-Puro (Clontech, 632183). All DNA constructs were verified by Sanger sequencing.
-
bioRxiv - Immunology 2024Quote: ... hTRIM21 full-length CDS with N-terminal Myc and EGFP was cloned into pLEX-MCS and transfected into HEK293T-Lenti cells (Clontech 632180) along with pMD.2G and psPAX2 (Addgene ...