Labshake search
Citations for Takara Bio :
51 - 100 of 1209 citations for Human PRPF31 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was carried out to evaluate the syndecan-4 expression between lenti-synd4 shRNA and lenti-null group with SYBP Premix Ex Taq TM from Takara (Shiga, Japan) following the manufacturer’s instructions ...
-
The E3 ubiquitin-protein ligase MDM2 is a novel interactor of the von Hippel-Lindau tumor suppressorbioRxiv - Biochemistry 2020Quote: ... Genes encoding the human MDM2 and pVHL30 proteins were obtained from commercial plasmid provided by GenScript (GenEZ plasmid OHu28568 and OHu23297) and cDNA transferred into pGBKT7 and pGADT7 plasmids (Clontech) to perform yeast two-hybrid assays (Y2H) ...
-
bioRxiv - Cell Biology 2022Quote: ... pLVX-IRES-Puro plasmid (Clontech) was digested with AgeI and NotI (FastDigest ...
-
bioRxiv - Neuroscience 2019Quote: Plasmid dsRed2-mito7 (Clontech #55838) was cut using NheI and NotI enzymes and then treated with DNA polymerase I Large Klenow fragment to isolate mito-dsRed2 cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGADT7 and pGBKT7 plasmids (Clontech) were transformed ...
-
bioRxiv - Bioengineering 2023Quote: ... pHelper plasmid (Takara Bio Inc.), the plasmid expressing Rep and serotype 8 capsid (AAV8) ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Molecular Biology 2021Quote: Plasmids were extracted from yeast cells by Easy Yeast Plasmid Isolation Kit (#630467, Takara Bio) and transformed into E ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmid or the enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1, Clontech/Takara Bio Europe). Transfections were achieved using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmid or the enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1, Clontech/Takara Bio Europe). Transfections were achieved using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... transfections also contained 0.2 μg of the pEGFP plasmid (Enhanced Green Fluorescent Protein plasmid, Clontech), and EGFP expression served as a marker of transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... plasmids were rescued from yeast using the Easy Yeast Plasmid Isolation Kit (Clontech Takara Bio). Protein interactions were confirmed by co-transformation of the Nwd1 bait with each candidate prey plasmid into Y2H Gold yeast host cells ...
-
bioRxiv - Neuroscience 2020Quote: ... plasmids were rescued from yeast using the Easy Yeast Plasmid Isolation Kit (Clontech Takara Bio). Protein interactions were confirmed by co-transformation of the Nwd1 bait with each candidate prey plasmid into Y2H Gold yeast host cells ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviral plasmids were packaged into pseudoparticles via triple-plasmid co-transfection into HEK293T cells (TaKaRa). pTsin or pWPI plasmids ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Biochemistry 2022Quote: ... Both pFCDUET-YopH phosphatase and pGKJE8-GroEl/GroEs chaperones plasmids (Takara chaperone plasmid set cat. # 3340) were used for co-expression experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... prey plasmids from library were rescued from yeast clones with “Easy Yeast Plasmid Isolation Kit” (Clontech) and sequenced ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting plasmids were used to generate the R mutant plasmid using the TaKaRaMutanBEST Kit (Takara). All strains were validated using the methods described earlier.
-
bioRxiv - Molecular Biology 2024Quote: ... and plasmid DNA was isolated using NucleoSpin® Plasmid (NoLid) kit for miniprep (740499.250; Takara Bio) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were constructed by PCR amplification of the whole plasmids with the CloneAmp Hifi polymerase (Takara) and assembly of the insert part with the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Bioengineering 2020Quote: ... Original pAUR101 plasmid purchased from Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... and the plasmid encoding DsRed2 (Clontech), cloned into a pCAX vector ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid pEGFPN1 was obtained from Clontech. TMPRSS2-FL cDNA (pcDNA3.1-SARS-2-S-C9 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid pRetroX-Tight-Pur (Clontech) and the PCR products have been digested with BamHI and EcoRI ...
-
bioRxiv - Microbiology 2021Quote: The plasmid pPTR I (Takara Bio), which carries the ptrA gene ...
-
bioRxiv - Microbiology 2021Quote: The plasmid pPTR I (Takara Bio) was used to construct the overexpression vector for the A ...
-
bioRxiv - Microbiology 2021Quote: ... or plasmid pPTR I (Takara Bio) were used as template DNA ...
-
bioRxiv - Microbiology 2021Quote: ... and plasmid pPTR I (Takara Bio) were used as template DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... pRC2-mi342 and pHelper plasmids (TAKARA). Seventy-two hours after transfection using Polyethylenimine HCl Max ...
-
bioRxiv - Neuroscience 2019Quote: ... A pmCherry-N1 plasmid (ClonTech, 632523) was utilised as a morphological marker in HEK293 immunocytochemistry experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... A peGFP-N2 plasmid (ClonTech, 632483) was utilised as a morphological marker in subsequent proliferating CTX0E16 experiments due to red fluorescent protein aggregation in CTX0E16 hNPCs.
-
bioRxiv - Neuroscience 2022Quote: ... mCherry of pmCherry-C1 plasmid (Clontech) was subcloned into pAAV-hSyn-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pmCherry-C1 from Clontech modified to add a myristoylation and palmytoylation sequence plus a linker (ATGGGCTGCATCAAGAGCAAGCGCAAGGACAACCTGAACGACGA CGGCGTGGACgaaccggtcgccacc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pEGFP-C1 plasmid (Clontech V012024) was used as the control ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were midi-prepped (Takara Bio), and BestGene ...
-
bioRxiv - Neuroscience 2023Quote: ... the eYFP encoding cDNA plasmid (Clontech) was precipitated onto colloidal Au particles (1.6µm ...
-
bioRxiv - Microbiology 2023Quote: ... and isolated by NucleoSpin Plasmid (TaKaRa). The introduced mutation was verified by Sanger sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... into ECFP-C1 expression plasmid (Clontech).
-
bioRxiv - Microbiology 2023Quote: ... pGP packaging plasmid (TaKaRa, Cat# 6160), and pMD2.G plasmid with TransIT-293 Transfection Reagent (TaKaRa ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Microbiology 2019Quote: Human fetal NSCs were purchased from Clontech (human neural cortex ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...