Labshake search
Citations for Takara Bio :
51 - 100 of 5288 citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Microbiology 2022Quote: Doxycycline-inducible stable cells overexpressing Trim69 were generated using the pRetroX-Tight system (Clontech), a murine leukemia virus (MLV ...
-
bioRxiv - Genetics 2021Quote: ... the lentiviral Lenti-X™ Tet-On® 3G Inducible Expression System (Takara Bio) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech) to make it SIN by a deletion in the 3’ LTR ...
-
bioRxiv - Genetics 2023Quote: Lentiviruses were produced using the Lenti-X Tet-ON Advanced Inducible Expression System (Clontech), following the protocol described therein ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: The Lenti-X Tet-On Advanced lentiviral inducible expression system (Clontech Laboratories, Mountain View, CA) was used to generate a doxycycline-inducible protein expression system in our stable OP9 FABP4-KO cell line ...
-
bioRxiv - Genomics 2020Quote: ... CDT1 cDNA was further cloned into the Tet-On 3G inducible expression system (TaKaRa, 631168) with a flag tag at the N terminal and an EGFP tag at the C terminal by the In-Fusion HD Cloning system (TaKaRa ...
-
bioRxiv - Immunology 2023Quote: ... a derivative of pInducer20-NA with the bidirectional doxycycline-inducible promoter from pTRE3G-BI (TaKaRa). Expression of VHH-HA and the C1C-EGFP inflammasome reporter was thus doxycycline-inducible ...
-
bioRxiv - Cancer Biology 2023Quote: We used the Lenti-X™ Tet-On® Advanced Inducible Expression System (Clontech, 632162) to produce the lentivirus vectors and transfect cells ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The inducible ABE plasmid was made by integrating a tet-responsive promoter (TRE3G, Takara Bio) and ABE 7.1050 (Addgene #102919 ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Developmental Biology 2022Quote: ... a lentiviral approach was developed using the Lenti-X Tet-On 3G Inducible Expression System (Clontech). The ORF encoding Fgfr2iiib (Origene ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the Retro-X™ Tet-One™ Inducible Expression System (Puro) (TakaRa Bio USA, Cat #634307). The CSF3R construct was cloned into a Gateway-converted pMSCV-IRES-GFP vector (a gift from Tannishtha Reya ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... listed in table S2) and inserted the 2xFlag_2xStrep_MST2 constructs (wild type or del_EDG) in the inducible vector pLVX (Clontech, #631847).
-
bioRxiv - Microbiology 2021Quote: ... The PCR products then were inserted into a Tet-on inducible lentiviral vector pLVX (Takara, Mountain View, CA) through EcoRI and BamHI restriction sites ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HAND2 mutant (HAND2mut) open reading frame was cloned into the doxycycline inducible pLVX-pTetOne-puro vector (Takara Bio) using In-Fusion HD (Takara Bio ...
-
bioRxiv - Developmental Biology 2019Quote: ... Stable transgenic cell lines were established according to the manual of the Tet-Express inducible expression systems (Clontech, 631169). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... a lentivirus vector encoding doxycycline inducible NET23/ STING fused to GFP at the C-terminus (pLVX-TRE3G backbone, Clontech) was prepared by standard procedures and transduced into HT1080 cells ...
-
bioRxiv - Cell Biology 2022Quote: HeLa cells stably expressing GFP-SNX32 from an inducible promoter were established following the distributor protocol (Takara Bio Inc.). GFP-SNX32 full-length gene was cloned onto pLVX-TRE3G Vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 1×105 cells of HeLa cells or BJ-5ta cells expressing inducible TM-mNG21-10 were transfected with 7.5 pmol of Cas9 (TAKARA), 7.5 pmol of sgRNA ...
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Neuroscience 2023Quote: The high-quality human total brain RNA that was used for 3’ RACE was purchased from Clontech (Mountain View, CA). SCA12 KI-10 and KI-80 mouse models were generated using the CRISPR/Cas9 approach by replacing the mouse PPP2R2B exon 2 with the human PPP2R2B exon 7 containing either 10 or 80 CAG triplets (Li and Margolis ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...