Labshake search
Citations for Takara Bio :
51 - 100 of 4941 citations for Human Corticotropin Like Intermediate Lobe Peptide CLIP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Biochemistry 2022Quote: ... Human DOCK10 DNA was synthesized by Clontech (NM_014689). The DHR2 domain of human DOCK11 DNA (NM_144658.3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2016) using anti-GFP (Living Colors A.v. peptide antibody, rabbit polyclonal, 1 mg/ml; TakaraBio/Clontech) primary antibody and horseradish peroxidase linked anti-rabbit IgG (from donkey ...
-
bioRxiv - Cell Biology 2023Quote: Procollagen Type 1 C-peptide (PIP) was measured according to the manufacturer’s instructions (Takara, Shiga, Japan). For evaluation of PIP ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human total RNA from different normal tissues from Clontech (Human Total RNA Master Panel II,Cat# ...
-
bioRxiv - Cell Biology 2019Quote: ... and human BaxS184V was cloned in pEGFP-C1 (Clontech). Bax/Bak DKO MEFs were grown in DMEM supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2019Quote: ... Human colon cDNA purchased from Clontech (Palo Alto, CA) was used as the template ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... and human-specific GFAP marker STEM123 (TaKaRa, cat. Y40420). As general astrocyte markers GFAP (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Normal human stomach tissue RNAs were purchased from TaKaRa Bio (Shiga ...
-
bioRxiv - Immunology 2019Quote: ... and Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2020Quote: Human induced pluripotent stem cells (iPSCs) (ChiPSC18, Takara Bioscience) were reprogrammed using a protocol for midbrain dopaminergic neurons adapted from Kirkeby et ...
-
bioRxiv - Cell Biology 2020Quote: Human telomerase-immortalized retinal-pigmented epithelial cells (RPE1; Clontech) either expressing LifeAct-GFP or parental (Vignaud et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... human CCDC22 was first cloned into pEGFP-C1 (Clontech) between Sal1 and BamH1 ...
-
bioRxiv - Microbiology 2023Quote: ... and the Mate and Plate Universal Human Library (Clontech). This yeast two-hybrid universal library was constructed from human cDNA that has been normalized to remove high copy number cDNAs (overrepresented transcripts ...
-
bioRxiv - Genetics 2023Quote: ... Human KISS1 was cloned into pLVX-neo vector (Clontech) for overexpression ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human iPSC line ChiPSC22 (Cellartis/Takara Bio Europe AB) was cultivated in the feeder-free DEF-CS system (Cellartis/Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2020Quote: ... and cloned downstream of a sequence encoding the CD8 signal peptide (MALPVTALLLPLALLLHAA) in the vector pIRESpuro3 (Clontech). BC-deltaSTP-GPR56 was from Lei Xu (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... An aliquot of the glycopeptide fraction was treated with peptide-N-glycanase F (PNGaseF, Takara, Shiga, Japan) in H218O to remove N-glycans and to label glycosylated Asn with 18O as Asp (18O) ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: Human CaMKII-α (Uniprot_ID: Q9UQM7) and human CaMKII-β (Uniprot_ID: Q13554) were cloned into the pEGFP-C1 vector backbone (Clontech, Mountain View, CA), after modifying the vector to contain a biotinylation sequence (Avitag ...
-
bioRxiv - Cell Biology 2019Quote: ... Human cript gene was also cloned into pEGFP-N1 (Clontech) using XhoI and BamHI to generate pEGFP-cript ...
-
bioRxiv - Neuroscience 2021Quote: ... and Human Brain Cerebral Cortex Total RNA (Takara Cat. #636561) was reverse-transcribed by Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...