Labshake search
Citations for Takara Bio :
51 - 100 of 694 citations for E3 Ubiquitin Protein Ligase RNF128 RNF128 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Biochemistry 2021Quote: The R3C ligase construct10 was cloned into the pRZ plasmid71 using the InFusion cloning system (Takara Bio, Japan). To ensure correct length of the transcript ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Cancer Biology 2020Quote: ... the TET protein expression in each clone was checked by immunoblotting using TetR monoclonal antibody (Clone 9G9) (Clontech, cat#631131). In addition ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ligation of a polyT-extruding adaptor (Sangon Ltd., China) was performed with E.coli ligase (Cat. #2161, Takara Ltd., Japan). Linear amplification of the ligated product was performed with adaptor-specific primer (Sangon Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... and a U2 adapter was ligated to each dsRNA fragment using T4 RNA ligase (Takara Bio Inc., Kusatsu, Japan). After denaturing the product ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
bioRxiv - Molecular Biology 2020Quote: ... The relative luciferase activity was determined by normalizing the firefly luciferase activity by the respective total EGFP protein amount quantified by Western blot using a GFP antibody (Clontech, 632460) in Image Studio ver 5.2 (LI-COR).
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... Annealed oligonucleotides were ligated into pGP-U6 (GenePharma, Shanghai, China) between the Bbs and Xho sites by T4 DNA ligase (TaKaRa) to produce pGP-U6-Mis-shRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The gRNAs used in this study were synthesized and inserted at BsaI site of pDC expressing vectors using T4 ligase (2011A, Takara). For dual sgRNA system ...
-
bioRxiv - Microbiology 2022Quote: ... The Kpn I – BamHI env fragments from the pSVIIIenv plasmids were cloned into the corresponding sites of pE7SB-NL4-3 using Long Ligase (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: The PCR products (3.2 kb or 2.0 kb of HBV-DNA if the 3.2-kb DNA was unavailable) were cloned into the vector PMD-19T with T4 DNA Ligase (Takara, Japan) and transformed into TOP10 Escherichia coli competent cells (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... between the pU6 promoter and sgRNA scaffold via Bsa I digestion and T4 DNA ligase-mediated ligation (Takara, cat. 6023). For oligonucleotide-dependent mutation knock-in ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Neuroscience 2019Quote: Sections were immunolabeled using an anti-DsRed antibody that detects the protein product generated by the recombined R26tdTomato reporter allele (anti-dsRed Ab from Clontech, Catalog (Cat) #632496 ...
-
bioRxiv - Microbiology 2022Quote: ... 2013) In which, once double digestion with MboI and MseI enzymes (Fermentas, Lithuania) and ligation by T4 DNA ligase (Takara Bio), PCRs by limited adaptors and primers were conducted (all used adaptors and PCR primers listed in Table S4).
-
bioRxiv - Microbiology 2020Quote: ... Construction of strains with cytoplasmic sGFP expression was performed by cloning the sGFP expression cassette from plasmid pIGPAPA and the neo cassette from plasmid pSD1 to the polylinker of plasmid pBluescript II (using the T4 DNA ligase, Takara Bio). The resulting plasmid pBS-GFP-gen was used to transform V ...
-
bioRxiv - Microbiology 2022Quote: ... the 3′ terminus of each strand of dsRNA was ligated with PC3-T7loop oligo (Table S1) using T4 RNA ligase (TaKaRa, China) at 16 °C for 16 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR products were purified using Dyne PCR Purification Kit (DyneBio, South Korea) and cloned into pPZP211 vectors using Takara T4 DNA Ligase (Takara Bio, Japan). Escherichia coli (DH5α ...
-
bioRxiv - Neuroscience 2023Quote: ... sagittal sections (50 µm) of the cerebellum were cut and incubated with antibodies against the reporter protein mCherry (Clontech 632543, RRID: AB_2307319, 1:500) and against the P-cell marker calbindin (Swant CB38 ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were tagged with Gfp (enhanced green fluorescent protein; Clontech, Mountain View, CA, USA) at their N-terminus unless noted otherwise ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized gene fragments went through cloning process after overnight digestion with restriction enzymes (Nde I, Xho I) at 37 °C and ligation (T4 DNA Ligase, Takara Bio, Shiga, Japan) into pET21 vector (Novagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein purity and concentration were determined by SDS-PAGE and BCA protein assay kit (Takara) respectively ...
-
bioRxiv - Biophysics 2019Quote: ... cDNAs encoding cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were purchased from Clontech Com ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Immunology 2021Quote: ... and the protein concentration was measured by BCA protein assay kit (TaKaRa, Dalian, China, cat#T9300A) as previous described(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was found to be 0.9 µg/µl using BCA Protein Assay Kit (TaKaRa).
-
bioRxiv - Microbiology 2022Quote: Protein-protein interactions were assayed with the Matchmaker yeast two-hybrid system (Clontech, Mountain View, CA). ORFs of AoHse was amplified from first-strand cDNA of A ...
-
bioRxiv - Physiology 2022Quote: ... Obtained luminescence was normalized to total protein concentration measured by BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Neuroscience 2020Quote: Enhanced green fluorescent protein (EGFP, Clontech), Tag-blue fluorescent protein (Tag-BFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... protein was estimated using BCA (TaKaRa), and 100 µg protein was incubated with 20 µl packed protein G-sepharose beads (Sigma P3296 ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...