Labshake search
Citations for Takara Bio :
51 - 100 of 1765 citations for 6 aminonaphthalene 1 3 disulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Microbiology 2021Quote: ... complementary to the DENV 3’UTR at 65°C for 3 hrs using ExpressHyb hybridization buffer (Clontech). Autoradiographs were quantified using ImageQuant (GE Healthcare).
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... Membrane blocking was performed with 3%BSA in PBS-t buffer for 1 h at room temperature followed by incubation with Mouse-anti-GFP (TaKaRa) (1/5,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... To purify the probes, 1/3 of the transcription reaction was loaded on a pre-spun (700xg, 5minutes) Chromaspin-100 column (Clontech) and centrifuged (700g ...
-
bioRxiv - Immunology 2022Quote: ... Sequences encoding DCFHP (residues 1-1146 of HexaPro)2 and SΔC-Fer (residues 1-1143 as previously described)3 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... cerevisiae strain AH109 (Matchmaker 3 system, Clontech) was used ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 3’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 mM maleic acid buffer pH 5.5) containing 100 mg Yatalase (Takara) and 100 mg Lysing Enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Cancer Biology 2021Quote: ... DAPI stained nuclei were diluted to a concentration of 60,000 cell/mL in 1x PBS + 1% BSA + 1x Second Diluent + 0.2U SUPERase·In RNase Inhibitor and dispensed onto the ICELL8 3 ‘DE Chip (Takara Bio, Cat# 640143) using the ICELL8 MultiSample NanoDispenser ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...