Labshake search
Citations for Takara Bio :
51 - 100 of 894 citations for 4 METHANESULPHONYLBUTAN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Microbiology 2023Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C with permanent mixing (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed using One Step SYBR PrimeScript RT-PCR kit (Takara Bio) on a 7900HT real-time system (Applied Biosystems).
-
bioRxiv - Immunology 2021Quote: ... utilizing the PrimeScript™ One-Step RT-PCR kit (Takara Bio, Shiga, Japan). PCR products were then separated and visualized by agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... One µg of total RNA was reverse-transcribed using PrimeScript RT reagent (TaKaRa) with oligo dT primers ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized using the one-step PrimeScript RT-PCR Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... A One Step SYBR® PrimeScript™ qPCR kit (TaKaRa Bio, Otsu, Japan) was used to synthesize cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2022Quote: ... was performed with one-step Prime script III RT-qPCR mix (Takara, Japan). The viral RNA of NP was detected by 2019-nCoV-N1 probe (Cat#10006770 ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram of total RNA and the PrimeScript RT reagent kit (Takara Bio.) were used to perform the first-strand cDNA synthesis ...
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of cDNA was added to the PCR-reaction premix (Takara Bio) with 10 pM corresponding primer pairs ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR was carried out using the One Step RNA PCR Kit (TaKaRa Biotechnology Dalian ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes 55 ...
-
bioRxiv - Genetics 2023Quote: ... Initially the Matchmaker® Gold Yeast One-Hybrid Library Screening System (Takara Bio) was employed ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Bioengineering 2024Quote: ... mixed with one-tenth of the volume of Lenti-X Concentrator (Takara Bio), and incubated at 4 °C for 24 h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pHISi-1 vector was provided by the Matchmaker one-hybrid kit (Clontech, CA). The 40 bp promoter sequence was originally cloned from the maize C1 gene promoter (22) ...
-
bioRxiv - Genetics 2019Quote: ... One microgram of RNA was then reverse transcribed using Primescript RT Reagent (Takara, RR047A). Quantitative PCR was performed using Fast Sybr Green Master mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... Use the One Step TB Green® PrimeScript™ PLUS RT-PCR Kit (Takara) to quantify the viral RNA copies through the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Bioengineering 2020Quote: ... Then qPCR was conducted with a One-Step PrimeScrip RT-PCR Kit (Takara, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The sgRNA library was prepared using a one-step PCR with ExTaq polymerase (Takara) and a mixture of P5 forward primers with staggers from 1 to 8 bp and barcoded P7 reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara, Kyoto, Japan). Preparation of PCR reactions was automated by the Echo 525 Acoustic Liquid Handler (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... using the One-Step TB Green® PrimeScript™ RT-PCR Kit II (Takara) for RT-PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 (Takara, #6045) according to manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... version 2 (Takara). Fastq files were generated from bcl files using BCL2FASTQ v2.17.1.14 with default parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (Takara Bio).
-
bioRxiv - Plant Biology 2020Quote: Y1H assay was performed using Matchmaker Gold Yeast One-Hybrid Library Screening System (Clontech, USA). The nucleotide sequences of promoter region of selected key defense genes having potential RAV1 binding motifs were retrieved by using online tool (https://bioinformatics.psb.ugent.be/plaza/) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized from 1μg of RNA via the One Step RT-PCR Kit (TaKaRa). Quantitative real time PCR was performed using the iQTM SYBR Green Supermix PCR kit with the iCycler apparatus system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed using a One Step PrimeScript RT-PCR Kit (Takara Bio, Otsu, Japan), and the following real-time PCR conditions were applied ...
-
bioRxiv - Microbiology 2022Quote: ... was performed using one-step Prime script III RT-qPCR mix (RR600A, Takara, Kyoto, Japan). The viral RNA of nucleocapsid protein was detected by a 2019-nCoV-N1 probe (10006770 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The viral RNA quantification was performed using One Step PrimeScript III RT-qPCR Kit (Takara). All reactions were performed on a CFX96 Touch instrument with the following quantitative-PCR conditions ...
-
bioRxiv - Zoology 2020Quote: ... Reverse transcription-PCR was conducted using a PrimeScript One-Step RT-PCR kit (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was reverse transcribed with Prime ScriptTM RT Master Mix (TaKaRa). Quantitative PCR assays were performed on a qTOWER apparatus (Analytic Jena ...
-
bioRxiv - Plant Biology 2020Quote: ... Yeast two-hybrid assay and one-hybrid assay were performed following the manufacturer’s instructions (Clontech).
-
bioRxiv - Microbiology 2022Quote: ... Purified RNA product was immediately used with the One-step PrimeScript RT-PCR Kit (Takara). Primers and probes were obtained from IDT ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast one-hybrid (Y1H) assays were performed according to the manufacturer’s instruction (Clontech, CA, USA). The coding region of PIF4 was amplified and cloned into the yeast GAL4 activation domain (GAL4 AD ...
-
bioRxiv - Microbiology 2023Quote: ... was performed using one-step Prime script III RT-qPCR mix (Takara Bio, Shiga, Japan). The viral RNA of ZIKV NS3 was detected by customized probe-based qPCR assay (Integrated DNA Technologies ...