Labshake search
Citations for Takara Bio :
51 - 100 of 236 citations for 4 Keto 13 cis retinoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acids were then extracted using the NucleoSpin Gel and PCR Clean-up XS Kit (Takara Bio 740611.250).
-
bioRxiv - Microbiology 2022Quote: ... expression was induced by addition of 4 ng/ml anhydrotetracycline (Clontech) at 4 hpi.
-
bioRxiv - Microbiology 2021Quote: ... 4 μl of 5X In-Fusion premix (Takara Bio, cat#638909), and milliQ water up to 20 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... cerevisiae SH-4 cells using NucleoSpin RNA (Takara Bio, Otsu, Japan) and Quick-RNA MiniPrep Plus (Zymo Research The MGIEasy RNA Directional Library Prep Set (MGI Tech ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 2.5 mM of each deoxyribose triphosphates (dNTPs) (TAKARA, Japan), and 1 μl of 10 mM of primers or TaqMan probes.
-
bioRxiv - Molecular Biology 2024Quote: ... and probed with primary antibody in 4% skim milk or Immunobooster (Takara). After washing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... For binding studies the 6xHis tag were removed from some Fabs by treatment with PreScission protease (MolBioTech; ThermoScientific) and the protein repurified on cobalt-nitrilotriacetic acid (Co-NTA) agarose (Clontech) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
bioRxiv - Microbiology 2024Quote: ... Dropout medium and plates were prepared with DifcoTM Yeast Nitrogen Base without Amino Acid (Becton Dickinson) and DO supplements (Clontech) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2024Quote: ... The concentration of AOPP was normalized to total protein content determined by bicinchoninic acid assay (BCA) assay (Takara Bio Inc.).
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... two to three amino acids in GFP-SP-BAP were replaced by alanine for each construct using the CloneAmp HiFi PCR Premix (Takara Bio) according to the manufacturer.
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Immunology 2023Quote: ... The expression vectors for the S variants with multiple amino acid changes or deletions were generated using the In-Fusion HD cloning kit (Takara Bio). The pcDNA3.1-hACE2 used to express human ACE2 (hACE2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total protein quantification was performed by a bicinchoninic acid (BCA) assay with a BCA protein assay kit (TaKaRa Bio, Shiga, Japan) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... 4 °C for 45 min and the supernatants incubated with TALON beads (Clontech) pre-equlibrated with purification buffer at RT over night with overhead rotation followed by washing with wash buffer (8M urea ...
-
bioRxiv - Immunology 2021Quote: ... were coated overnight at 4°C with 20 μg/ml Retronectin (Takara T100B). Viral supernatant was spun for 90 minutes at 2,000g and 30°C onto the plated retronectin and half the supernatant volume removed carefully after spinning ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the supernatant was incubated with 4 ml TALON metal affinity resin (Clontech) at 4°C for 1 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... fixed for 1 h in 4% paraformaldehyde/PBS (TAKARA BIO INC. Cat#T900), and subjected to antibody labeling ...
-
bioRxiv - Microbiology 2024Quote: ... each 100 μL reaction contained 4 μL Titanium Taq DNA Polymerase (Takara, #639242), 10 μL Titanium PCR buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Residual DNA and ssRNA were eliminated from the extracted nucleic acids using 2U DNase I (Simgen, Hangzhou, China) and 10U S1 nuclease (TaKaRa, Dalian, China) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The ΔPro ADAM17 (amino acid 215-824) was inserted into the pRK5M-myc expression vector behind its native signal sequence using Infusion Cloning (Takara Bio Inc.). Each expression construct was validated by Sanger sequencing.
-
bioRxiv - Plant Biology 2020Quote: ... After 4 h total RNA was extracted using RNAiso Plus (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol and used for real-time quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was applied to 4-mL Talon Metal Affinity Resin (Clontech, cat# 635503). After washing with 30 mL wash buffer containing 20 mM HEPES at pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the larvae were fixed in 4% PFA for imaging or RNAiso Plus (Takara, 9109) for RNA isolation.
-
bioRxiv - Biophysics 2021Quote: ... The resultant supernatant was mixed with 4 mg of Talon Metal Affinity Resin (Takara) equilibrated with wash buffer [50 mM Na-Pi pH 8.0 ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Genomics 2024Quote: Approximately 4×106 HAP1 cells were transfected using Xfect Transfection Reagent (#631318, Takara Bio) for each pSpCas9(BB)-2A-Puro construct ...
-
bioRxiv - Neuroscience 2023Quote: ... the mouse monoclonal anti-GFP (Jl-8, Clontech; 1:500 overnight at 4°C) primary antibody was used ...
-
bioRxiv - Plant Biology 2022Quote: ... StNPR1 and StNPR3/4 were inserted also into the pGADT7 (prey) vector (Clontech, USA), to produce proteins with an N-terminal Gal4 activation domain ...
-
bioRxiv - Bioengineering 2024Quote: ... Cas9-EDVs were produced by seeding approximately 4 million Lenti-X cells (Takara Bio) into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Immunology 2021Quote: ... containing chilled (4°C) RNA lysis buffer (SMART-Seq HT lysis buffer, Takara Clontech, #634439). This contained the oligo-dT primer ...