Labshake search
Citations for Takara Bio :
901 - 950 of 1011 citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
A GID E3 ligase assembly ubiquitinates an Rsp5 E3 adaptor and regulates plasma membrane transportersbioRxiv - Cell Biology 2021Quote: ... pGADCg- and pGBKCg-based plasmids containing the indicated protein fusions were transformed into the yeast strain Y2HGOLD (Takara Bio), and double transformants were selected by growth on SD media lacking leucine and tryptophan ...
-
bioRxiv - Cell Biology 2021Quote: ... red fluorescent protein fused with the mitochondrial targeting sequence from cytochrome c oxidase subunit VIII (Clontech, Mountain View, CA) using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
bioRxiv - Molecular Biology 2022Quote: ... red fluorescence protein (DsRed) and NK-NT or NKN1 fragments were cloned into pET6xHN-N Vector (Takara, CA, USA). HEK293T cells were cultured in FP medium (DMEM containing 10% FBS ...
-
bioRxiv - Biochemistry 2024Quote: ... The other 2A proteins were separated from the lysate using immobilized metal affinity chromatography with either TALON beads (Clontech) or chelating Sepharose beads charged with NiCl2 (Cytiva) ...
-
bioRxiv - Plant Biology 2022Quote: Y2H protein interaction assays were performed according to the manufacturer’s instructions as described in the Yeast Protocols Handbook (Clontech; TaKaRa Bio USA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Microbiology 2024Quote: ... The protein-bead mixtures were then loaded onto a gravity column (TALON 2 mL Disposable Gravity Column, Takara #635606). Lysate was loaded into the column 5 times with gravity flow and then washed in a 1M NaCl buffer 3 times ...
-
bioRxiv - Biochemistry 2024Quote: ... The enzyme solution contained 3.38 μg/mL ORF1110 protein (residues 45-635 with no mutation) and 0.2% bovine serum albumin (TaKaRa Bio). At final concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... The AD fusion protein was created by cloning the genes of interest in the prey vector pGAD424 (Clontech laboratories), having the LEU2 selection marker ...
-
bioRxiv - Cell Biology 2020Quote: ... To detect the transgenic GFP-tagged Abl proteins we used anti-GFP (JL-8, 1:500 or 1:1000, Clontech). Anti-αTubulin (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... Then the homology arms and fluorescent protein sequences were assembled and cloned into the BamHI site of a pUC19 vector using Gibson assembly (Clontech). The primer sequences for the mGFP-EB1 ...
-
bioRxiv - Developmental Biology 2020Quote: Doxycycline-inducible overexpression of HA-tagged proteins was achieved using the Lenti-X Tet-On 3G Inducible Expression System (Clontech) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... as described previously (Keith et al., 2012, Freund et al., 2016) with plasmids encoding green fluorescent protein (GFP) (pEGFPN1; Clontech), mouse Kif11 (Myers and Baas ...
-
bioRxiv - Molecular Biology 2021Quote: Stable 3T3 cells (ATCC) overexpressing zDHHC3 or green fluorescent protein (GFP) as a control were generated using the pLVX lentiviral system (Clontech). Cells were labeled by stable isotope labeling with amino acids in cell culture (SILAC ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Genes of target prokaryotic proteins were amplified by PCR from corresponding genomic DNA and inserted into the pEGFP-C1 vector (Clontech). Mutated genes of prokaryotic proteins were obtained by PCR site-specific mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: 293T were transfected with full length SARS-CoV-2 Spikes and a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) using the calcium-phosphate method ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Microbiology 2022Quote: ... PreS2-LHBS sequence (deletion nucleotides 2-55) was cloned into the protein stability construct after the c-terminal of EGFP by In-Fusion cloning (Takara). The protein stability construct was a kind gift from Dr ...
-
bioRxiv - Microbiology 2022Quote: ... Virus production was quantified by determining the amount of the Gag p24 protein using an enzyme-linked immunosorbent (ELISA) assay (Innogenetics or TaKaRa). For production of HIV-1 Env-pseudotyped viruses in Jurkat cells ...
-
bioRxiv - Plant Biology 2022Quote: ... The immunoprecipitated (RGA-GFP and RGAm2-GFP) and co-immunoprecipitated (IDD2-RFP) proteins were detected by western-blot with anti-GFP (JL8; Clontech) and anti- RFP (6G6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the TET protein expression in each clone was checked by immunoblotting using TetR monoclonal antibody (Clone 9G9) (Clontech, cat#631131). In addition ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
The Arabidopsis F-box protein FBW2 degrades AGO1 to avoid spurious loading of illegitimate small RNAbioRxiv - Cell Biology 2021Quote: ... Yeast transformation as well as yeast protein extraction were performed following the recommendations presented in the Yeast Protocol Handbook PT3024-1 (Clontech).
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant protein were purified to >90% electrophoretic purity by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with imidazole as described previously24 ...
-
bioRxiv - Molecular Biology 2020Quote: PJ69-4a strain of Saccharomyces cerevisiae was used for the expression of proteins of interest using the Matchmaker Gal4-based yeast two hybrid system (Clontech). Tested bait/prey combinations were co-transformed into PJ69-4a and cultivated at 28°C ...
-
bioRxiv - Cell Biology 2020Quote: ... generates a protein that undergoes spontaneous aggregation that reverses upon the addition of D/D solubilizer (catalogue# 635054; Takara Bio), a cell-permeant rapamycin analog that binds to the FM4 domains (see Fig 3e).
-
bioRxiv - Immunology 2020Quote: ... For binding studies the 6xHis tag were removed from some Fabs by treatment with PreScission protease (MolBioTech; ThermoScientific) and the protein repurified on cobalt-nitrilotriacetic acid (Co-NTA) agarose (Clontech) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 × 106 HEK293T cells were transfected with 7 μg of Env expressor and 1 μg of a green fluorescent protein (GFP) expressor (pIRES2-EGFP; Clontech) with the calcium phosphate method ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant His-tagged protein was purified from cell free extracts in a single step using immobilized affinity chromatography (IMAC) with Talon resin (ClonTech) and dialyzed overnight into 20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2024Quote: ... pLysS or Rosetta pLysS cells and overexpressed proteins were purified using immobilized metal-ion affinity chromatography (IMAC) with TALON resin (Clontech) (Abad et al ...