Labshake search
Citations for Takara Bio :
901 - 950 of 1352 citations for Mouse Anti Hepatitis B Virus Core Protein Antibody 1824 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... anti-FOXG1 (1:500, rabbit; Takara), anti-MAP2 (1:500 ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-GFP (632381; Clontech, USA) antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Crx (rabbit; 1:200; Takara), anti-Recoverin (rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Myc (1:1000) (Clontech); rabbit anti-HA (1:800 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rabbit anti-Dsred (Takara, Cat# 632496), Goat anti-GFP (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:1000, Clontech), mAb anti-Bruchpilot (nc82 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Ocn (Takara, M173; 1:800), anti-CD31 (BD ...
-
bioRxiv - Cell Biology 2021Quote: ... for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio) for the cells following manufacturer protocol.
-
bioRxiv - Biophysics 2021Quote: Full length mouse ILK cDNA was cloned into the EcoRI site of pEGFP-N1 plasmid (Clontech). The R255A ...
-
bioRxiv - Plant Biology 2019Quote: Each purified protein preparation of His-PHOT1 N2 and N4 was incubated with TALON Magnetic Beads (TaKaRa) at 4°C for 30 min and further incubated at 4°C for 30 min with in vitro transcription and translation reactant containing RPT2 N ...
-
bioRxiv - Plant Biology 2019Quote: ... 30 µg of microsomal proteins were then treated with 30 units of calf intestinal alkaline phosphatase (TaKaRa) at 37°C for 2 h ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Concentrated protein was bound to 0.5–1 mL of His60 nickel or HisTalon cobalt resin (Takara Bio) for 0.5–1 hr at 4°C while rotating in a 10-mL Pierce disposable column (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340). When the optical density at 600 nm reached 0.6 ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Microbiology 2021Quote: U937 cell lines stably expressing red fluorescent protein membrane were generated using pDsRed-Monomer-Mem (Takara Bio) cloned into pLB vector from Addgene (Addgene plasmid 11619 ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Plant Biology 2019Quote: ... Proteins were transferred onto a PVDF membrane and blotted using 1:2000 a-GFP (Cat 632381, Clontech), 1:2000 a-actin (AS13 2640 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP.
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... After 12 h medium was collected and recombinant proteins were purified on TALON metal affinity resin (Takara). 200 μl of the resin was loaded onto 1 ml column (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... The concentration of the purified protein was assessed by densitometry using bovine serum albumin (TaKaRa, cat. # T9310A) as a standard following SDS-PAGE and staining with the Q-stain ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs encoding for sequences of proteins of interest were amplified and inserted into pEGFP-N1 vector (Clontech). Each DNA construct was checked by conventional Sanger sequencing of purified plasmid.
-
bioRxiv - Bioengineering 2024Quote: ... All proteins were purified with a Talon metal affinity resin (Takara Bio USA, Mountain View, CA, USA) and dialyzed against pyrogen-free PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Developmental Biology 2022Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... the following antibodies were used: Rx (rabbit; TaKaRa, #M228; 1:1,000), Nkx2.1 (rabbit ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Plant Biology 2024Quote: ... We then ran a western blot using the GFP antibody (Takara living colors EGFP monoclonal antibody JL-8 ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse ESCs were seeded on a gelatin coated dish and cultured in the NDiff 227 medium (TAKARA) for 5 days33 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The GFP-mCDCA7 construct was generated by cloning mouse Cdca7 cDNA into the pEGFP-C1 vector (Clontech). The GST-mCDCA7 CRD (pXC2025 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...