Labshake search
Citations for Takara Bio :
901 - 950 of 4940 citations for Human Complement C3 Convertase C3c CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified using the Library quantification kit (Takara) and Thermal cycler Dice Realtime TP800 (Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... Following purification with Zymoclean Gel DNA Recovery Kit (ZD4008, Takara), product size distribution and quantity were assessed on a Bioanalyzer using an Agilent 2100 high-sensitivity DNA assay kit (5067-4626 ...
-
bioRxiv - Cell Biology 2022Quote: In-Fusion cloning (In-Fusion HD Cloning Plus Kit, Clontech) was used to fuse the fragments with the linearized backbone ...
-
bioRxiv - Genetics 2022Quote: ... The SMART-seq v4 Ultra Low input RNA kit (Clontech) was used to amplify cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesised using the PrimeScript II kit (Takara Bio). Total RNA and genomic DNA from A ...
-
bioRxiv - Microbiology 2022Quote: ... using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Real-time qPCR experiments were performed as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthesis of cDNA was performed using cDNA synthesis Kit (Takara). The qPCR was conducted on the Applied Biosystems instrument using the SYBR Green Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... or PrimeSTAR Mutagenesis Basal kit (Takara Bio Inc., Shiga, Japan): Y156V ...
-
bioRxiv - Plant Biology 2022Quote: ... using an In-Fusion HD cloning kit (Clontech Laboratories, USA). Targeting vectors were introduced into F1 sporelings of M ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and pLL3.7m plasmids using CalPhos mammalian transfection kit (Takara Bio). Two days following transfection ...
-
bioRxiv - Systems Biology 2022Quote: ... viruses were purified using the Retro-X Concentrator kit (Clontech) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and pAAVDJ using the In-Fusion HD Cloning kit (Clontech) and QuikChange II Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using NucleoSpin Gel and PCR Clean-Up Kit (Takara), cloned into pRACE vector (provided in the kit ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa). qPCR was performed using the SYBR Green Master Mix (High ROX Premixed ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoBond HMW DNA kit (Takara) per the manufacturer’s instructions with a 50 °C proteinase K incubation for 4.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After transcribing using the In vitro Transcription T7 Kit (TaKaRa), BHK-21 cells were cotransfected with both full-length genomic and nucleoprotein gene RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the SYBR Premix Ex Taq kit (Takara, Shiga, Japan) was used as the reaction solution ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Bioengineering 2023Quote: ... The virus titer was determined using AAVPro titration kit (Takara).
-
bioRxiv - Genetics 2023Quote: ... RT was carried out with the PrimeScript Kit from TaKaRa. Quantitative RT-PCR reactions were carried out on a Real-time PCR machine (QuantStudio 5 by Applied Biosystems) ...
-
bioRxiv - Genetics 2023Quote: ... A Guide-it IVT RNA Clean-Up Kit (Takara Bio) was used to clean up the sgRNA solution ...
-
bioRxiv - Biophysics 2023Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection was done using the CalPhos mammalian transfection kit (Clontech). Alternatively ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). The plasmid was amplified using NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan); PrimeScript RT-PCR Kit (Takara Bio ...
-
bioRxiv - Biophysics 2023Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Virus titers were determined using AAVpro Titration Kit Ver2 (TaKaRa).
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was extracted using a commercial kit (Takara, Japan) in line with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted using the NucleoSpin RNA Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs were synthesized using PrimeScript RT reagent Kit (Takara, Dalian) and then diluted and subjected to quantitative PCR using TransStart Green qPCR SuperMix (TransGen Biotch ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was synthesized using the PrimeScript RT reagent kit (Takara) and used as templates for real-time PCR analysis using SYBR PreMix ExTaqII (Takara) ...
-
bioRxiv - Microbiology 2023Quote: ... using a DNA Ligation Kit (Mighty Mix, TaKaRa, Cat# 6023). The ligated constructs were then transformed in NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Neuroscience 2023Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Neuroscience 2023Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Genetics 2023Quote: ... and Unique Dual Index Kit (U001-U024) (Takara Bio #634756) with some modifications ...
-
bioRxiv - Plant Biology 2023Quote: ... paired-ended libraries were constructed using SMART ChIPseq kit (TAKARA) and sequenced using HiseqX ...
-
bioRxiv - Plant Biology 2023Quote: ... and standard PCR was performed using ExTaq HS kit (TaKaRa). Control reactions were run using wild-type DNA as a template.
-
bioRxiv - Neuroscience 2023Quote: ... Infusion cloning (Takara-Bio In-Fusion HD cloning Kit; 639650) was used to clone in EF1-alpha promoter generating a pAAV.U6.shRLuc.EF1-α.ZsGreen.SV40 plasmid and express ZsGreen under EF1-α promoter (Table 2) ...
-
bioRxiv - Plant Biology 2024Quote: ... or the SMART-Seq mRNA LP Kit (Takara Bio USA) (for pre-parasitic J2 library generation) ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). Plasmids were amplified using NEB 5-alpha F′ Iq competent Escherichia coli (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared with SmarSeq Ultra Low input kit (Takara).
-
bioRxiv - Immunology 2023Quote: ... and spleen tissues using an RNAiso Plus kit (Takara Bio), and subsequently reverse transcribed into cDNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... by PCR using a PrimeSTAR Mutagenesis Basal Kit (Takara, R046A) and the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... using the In-Fusion ® HD Cloning Kit (Z9648N; TaKaRa).
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized by SMART-Seq mRNA kit (Takara, 634772). Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SYBR RT-PCR Kit was purchased from Takara (Dalian, China). PHrodo-labelled E ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...