Labshake search
Citations for Takara Bio :
901 - 950 of 1338 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... for A3>P: 5’-aaaacacugaaccug-3’ for A2>P: 5’-aaacacugaaccug-3’) were incubated with 10 U recombinant MazF (Takara Bio) in 20 mM Tris pH 8.0 ...
-
bioRxiv - Genetics 2024Quote: ... The 4–11 kb fragments of the DFR-B sequence were amplified by PCR using the primers DP-LF (5′-TTAACATGAGGGGATTGCATGTCACTTTCA-3′) and D3U-LR (5′-CATAAATCTGGTTCGAGTGGCAATCTAACT-3′) with Ex-Premier DNA Polymerase (TAKARA, Japan). The PCR conditions were as follows ...
-
bioRxiv - Genomics 2020Quote: ... with a flag tag at the N terminal and an EGFP tag at the C terminal by the In-Fusion HD Cloning system (TaKaRa, 638909). After transfection of the U2OS cells with the pCMV-Tet3G Vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full-length WDR5 was cloned in frame as N- or C-terminal NanoLuc-fusion pNLF1 vector using ligation independent in-fusion cloning (Takara Bio) and sequence verified ...
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
bioRxiv - Genetics 2020Quote: ... The amplified fragment was cloned into the AscI site of pBM61::CCGp-N-3xFLAG (80) by InFusion cloning (Takara, cat. # 639648). The new plasmid was then digested with DraI and transformed into a his-3;mus-52::bar strain ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Cell Biology 2022Quote: ... ACLY lentivirus constructs were generated by inserting ACLY variants with an N-terminal MYC tag into pLVX-IRES-Puro (Clontech, 632183). All DNA constructs were verified by Sanger sequencing.
-
bioRxiv - Microbiology 2024Quote: B263R was amplified from gDNA of ASFV and cloned separately into vectors pCMV-Flag-N (635688; Clontech, Mountain View, CA, USA), pCMV-Myc-N (635689 ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid was used to generate N-terminal-truncated MGME1 (ΔN-MGME1; residues 95 to 344) by means of In-Fusion Cloning (Takara Bio). Constructs expressing the MGME1 variants used in this study were generated by site-directed mutagenesis using the pSol-His8-SUMO-MGME1 plasmid as template ...
-
bioRxiv - Biochemistry 2023Quote: ... 425 – 658) and SipAC-Core (a.a. 512 – 658) were cloned with an N-terminal 6xHis-tag into pColdI vector (Takara Bio USA) modified to include a tobacco etch virus (TEV ...
-
bioRxiv - Immunology 2024Quote: ... the sequence encoding the N-terminal Avi-tag was removed from the expression plasmid using In-Fusion® cloning (Takara #638948) prior to protein expression and purification ...
-
bioRxiv - Molecular Biology 2024Quote: ... was PCR-amplified from SK-N-BE cells cDNA and cloned between the ICSs using In-fusion Cloning Kit (Takara Bio). 4xPepper array sequence (196 bp long ...
-
bioRxiv - Immunology 2024Quote: ... hTRIM21 full-length CDS with N-terminal Myc and EGFP was cloned into pLEX-MCS and transfected into HEK293T-Lenti cells (Clontech 632180) along with pMD.2G and psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... The Re plasmid in the study is generated by cloning the basic repeat unit of MUC19 into the pCMV-Myc-N vector (Takara, Japan). For CRISPR systems ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hpi using the CellAmp Direct RNA Prep Kit (3732; Takara, Japan). The RNA was then diluted in water and boiled ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a non-TC treated 6 or 12-well plate was coated with 20 ug/mL Retronectin (Takara) in PBS and incubated at 4°C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Microbiology 2022Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat# 635683) column was equilibrated with ten column volumes of Equilibration Buffer (HisTALON Buffer Set ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 5 μL of Premix Ex Taq (Takara, Dalian, China), and 1.5 μL of a mixture of probe (5’-TGCAC GTTGT GACAG TCGT-3’ ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 2.5 mM dNTPs (Takara Bio Inc.), 1 μL of 20 μM TruSeqUniv (Supplementary Table S7) ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 10× ExTaq buffer (Takara Bio Inc.), 5 μL of 2.5 mM dNTPs (Takara Bio Inc.) ...
-
bioRxiv - Genetics 2020Quote: ... 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa, Shiga, Japan), self-ligated by T4 ligase (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat # 635683) column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 units of recombinant DNase I (TaKaRa, Kyoto, Japan), 200 units of RevertAid™ reverse transcriptase (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 U of Taq DNA polymerase (TaKaRa Bio) was subjected to PCR using a thermal cycler (Applied Biosystems 7300 real-time PCR system ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 5 µL of 2.5 mM dNTPs (Takara #4025), with the following thermal cycle condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then 5 μL 10× Klenow fragment buffer (Takara), 5 μL dNTP mix (0.2 mM dATP ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was then cloned into the BG1861 vector by ligation-independent cloning to introduce a N-terminal 6xHis tag and transformed into Stellar™ chemically competent cells (Clontech Laboratories) for plasmid propagation (84) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Microbiology 2022Quote: ... An internal ribosomal entry site (IRES) was inserted behind the ACE2 sequence via restriction digestion of a pEF1a-IRES vector (Cat. n° 631970, Takara Bio Inc.) with NheI-HF and SalI-HF (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... the HCoV-OC43 N sequence was cloned into backbone vector pLVX-EF1alpha-2xStrep-IRES-Puro by In-Fusion cloning (Takara Bio, Inc.), obtaining pLVX-EF1alpha-OC43-N-2xStrep-IRES-Puro.
-
bioRxiv - Biochemistry 2024Quote: ... removal of N-terminal signal peptide and introduction of mutation was performed based on the manufacturer’s instruction using PrimeSTAR MAX (Takara Bio, Shiga, Japan). The resulting plasmids were introduced into E ...
-
bioRxiv - Cancer Biology 2024Quote: ... The wild-type AKT1 (NM_001014431.2) was cloned in the pECMV-3×FLAG-N vector using the In-Fusion® HD Cloning Kit (Takara Bio, Cat# 639650). The K20R and K20Q mutant AKT1 plasmids were constructed using the Fast Site-Directed Mutagenesis Kit (TIANGEN ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...